PK!N _rels/.rels (j0 @ѽQN/c[ILj<]aGӓzsFu]U ^[x1xp f#I)ʃY*D i")c$qU~31jH[{=E~ f?3-޲]Tꓸ2j),l0/%b zʼn, /|f\Z?6!Y_o]APK!~A word/footnotes.xmlr0;w`wEH:4(B6La$o׃2OV V8{t.<ס4ەy6#2a0T;:.%Y12FH2XNbc`Hl69*E{ՕTPaGX5RKp)"V:3d(ꃂ aQͨ9z(fH67G 8R'EHtbrŰ[E XbEn c"j ,Lo&,)-´S<'փÖ喈LM㫆c*jH(rv6Y_ sڿZ[r:8D~}v8)Ni (a£Bs\`iA0'tˢaD5-'XV t*wb:5iv%h⊬/68úMtK#;~~(-k:Uy믉yͰNHBAy8NuvD%=Tv{֎1)csTbP.lNA ν[. wrihlLZ%.nƷ\:]֒ oz!v »0̰̜쌼X8r:}ߎalI8uuMb0=s ~<7F&:[.ՙJe&j2%&`b{BC+g?x͝dBZs']|핊LxT}2n W>>*GywMU5;O˟>~o^lqG=vIENDB`PK !kW66word/media/image2.pngPNG  IHDRW?sRGBgAMA a0PLTEP``PXhPZePXdSYfRZeRYdRZdRZeRZeQYeSZeRZeRZeRZeʼtRNS 0@P`p pHYs&?tIDAT(SQ D,-mC\S.zL0=^T_-r|YN$G{comQi/ ~I%`x$O7M"Xߕדu|)O}ç?k&)| Mk?E]91)!z}O6iB@Eq}SGTsL?7 tE08o2k2h}6˟]bGq%6[_׿gN+cƯݻIf~_^קƿ<_86"a*CO\W}5xe9/}㿟^mJGkZ`H~_[,`lkz|>LRi:؜e*Nkc^NK/:?y<ܩzJ=8/:/S98M7cztSR2ՇcOK+c7.>ܲ+7X|e*>Vx|~2ջtSl=Z9 s dR+|!'/x>o}<fٕtcRҗԯ݈Re%L 6}07!%}cVN19L,W\?]L1xt4=y<濴\ zx(x%S+8/m#_/lK̗` }cy(i=y<VhY<̗4N4_j_/_ 1(iZp2ջtcP_Xe*نju66%k 1<kqhmJV.b|YNlKpe٦$ֿ i f$Xs3bɡtOZV. >IITc|YN^N6$W-S9.6$M:$;,rnI{ju vI˘r UmKZ9a Ɲ$aTc>[lN>nOKw<{>du:ϗ$#-rnI*h$չ >ء}9'IZs CZrnIWm GJVNcX~2ջt3N1%ཞw<ۈ評?L!ۄoy,'1LoM'I} S,S9'm7I$1\?shumIQotMe*1l?J]mIQ<_Zv&h>/o$m?QlIi c@wmIґׯ-a xޕlcMS+1R>djZXiu&I+j] k0~b6$im͗$7ˡlMVY`T 4IZqϻr6$iյ:0۷L:8 M w]Uli&Ie/I {Mdla&I>=؞~"IL,?ؖClL2`;w< -E ~UT1It`ݖ]I7$ipO٦$ S+1,:f$ T%EXe*gF$S+1<Zg`4d1<z,SN7$iZa|Uj?n~I͗$K8nk%Iz>K8^VN+1lq:6$I9M8>Dk%I\ c*uC%IJju/I p]I7$I?>Q~k?ɚllI~U+1ZznjI~)|]96$Io突VW.S}6$I9VzTӍ,Iһש _'VM,I5_fkZ6$IPf-S9s_>]9>W?mZI>Vn醕$Zv&]xUT*I<_~cF$3>N?O&TOjY 1SqcJkWb?+Ɣ${j"c}UTM)Iܯaa~ϲ+7醔$Zz2_?qOfQ/}ަP/_32lJ}=y 6V$kua~mu$I]|Uj?am:Iİ ~4l$U1l'Ju+1|:6$I2$x[r8W.S}6$IG\s%sFM$IZC10~r M6$Ik2ջt3I^2l#IZWZgHC<#Yrn IV[%yFlHr=[wh64$mV1eTΜm+1UdhY$IP1EDhQ$I\ˮW.S}6$Iy,'1 $hA$Ir1 h? l I62Xew٦$i_b:`͞w<$S+1-FUT I@:9!fu$I~LLI?O|f@Ak4 m#I~-LL2lG]9cwhumHԯcL:$)Zv& |U2lG6_>86Dg#IR}L~lH+1p,I~mLL#~3ؑ$W-S4_L!ԑ$闵:kdbZ,rnHƖŴw'6l3GwiL/|~b3đ$靽)1𕖩e8$nO\4W96o$IZc+,SN7n$IZ4_Oh6$}@e9iϲMY#I҇>>áS%I_G'2MI>V~H$fA#I'կi0_L!ۜ$ju/ILG~3ݘ$?O^Ɇ$I_S+1-𻖩ޥ1$}Q/scLK]96b$IZ J=6a$IZoL:݀$4[9|$[k4+~m"Iw>+~fʙcyWcf$IGSsL[dtE#kٕe&$I|YNbo$e"Iw]?ASN6V$I:51p*$~}MLgc'' IS+1i*uC"Ijju0eWnҍIV2ջOJ&$IӘqh6<$ikmb2lDELwwhumHZcضe*醉$I[ۘi*L7K$IPe9`{]6I$I\cؖ~IH=yLOBf#$mVL7F$Ixm*uC)"IkuĴ^c!"I8ǴNc?lH4V>TMIeN|`]e $S+1M|U}!IҰ:92KL:$i81]8?g$VNc8^VoIWc8NTΜ$=yLǧh69$I: p\ItC$-r(qJ]mnHo,'1|~1Ԑ$I>SO.{ I􆖩Ŵ }e$mktbZϻrmdHEL_k*uC!IYsV'YL:$IUV'YO$IZ9ZM7-$Iկ׉s-S96,$IEL>۬$ITsLcuQ!I>VocXUTM I͗$aM9!I>V1 |~GnNHOyWc:s!!IV瘎L?ynHH/iuLg*uC!IV~OLM!Iާ4' Ir4-SK7$Iҷ27?4 6TβI=r5Zg$kuJ)-SN7$IQԯi Of$I:r7[v&d$IGVӡS%IZOϻr8' It:4~0X$IG]'s`tUTMIt:ϗ$u`d` I}L~r0H$I+jYLe$i]1yޕlA$V.bF1_zhumHܯ2t@$~OL94$IӘ-;znHML!}`9/I{ޕ-:6 $Ijuؚ~0 $I۬x b*uc9 I6|YNu؂eWnMIuX~lHkf IƩ_ZF$Ie*z|U2Շl@$ Vs(^5Yv&$Iv Z~_/IFx]m/Inc.nY/I{j"^cvhu-K$ Zr.K$ew~/[$IkpL]%IZkp, >%I{{ޕxA?-K$Vx[?.K$~PVe*uC/IZuBz|~b/]ȗ$Iz_z|~RK%I2x2ջl^$wzyx z½$IҟEnm*>[$IZ5C|e*邽$Iԯ9[$IZ93ZM%I>e|e*gNKyW5HV$Iҧ!G'҅yIOlٕx|Uj7[$Ir%'xI/>^KOwxI/_G'Xz-K$}e/$zW?i-K$}GT5xe$Iҷܯ'- t]${W~.Yp$IZ9gަ$IG2xm2l]$zj"^_̡}.ItT: e*$IL.^cWtuIcm,':tˮd$IG]xɹ~n.It=ySq!]$i5:k K%IVT(^o`^`; 8%Ih=y6p٢$IҦku!X~-]$I~ RzW.S}%IFi,'zOe$IuG>[6Y$I~-R&,S%IF1^`= l[$i䖩\Cl[$iZ5IǭlK%Iԯ&8^q%IrOpަܒ$Iߖ>e*gNK$V.5 ˡ}-IVx+¶$IVou |Uj6]Ԗ$IO/IVZv&[̖$IjuU}~m-I7կS+-IwWIt[$I_YuR>dג$IZJ_PK%I'|~2PK%Ir]ަՒ$I㖩>k|e*gB$I>V. >ǡ}H-Iy*5^c-SN%I-S08Z?-NK$j4^c,r.JK$jucr$I+Z<%I:k~,]$Iҗկc3xe"$I~-Sf$IxM'}³$I~=S,S%I}=2lY$IS+n*>[l$Iܯk7-SN%It4 [EfI$YkC$Iegʙ$I꩕xZgʒ$I:Zuw<]P$Im0~l,IU4_x`TˮdȒ$IZQbtY$I_yf]x,IyK%Iږ\#J]-K$iŵ:k'cI$mx`~2,Y($IVj4^تC"$I62x`e Ē$I^O\k [shu-K$i:UXr. K$i-SAf’$Ixk!kM,I>^ X_`I$ !ku $IVx=`ItX$IկDd*uC+I1C"kOxe$Ix]` ɮ~k+I[rewb$I~+[$Ix}XZg$IܯWH2tW$I~mTFpLRIlqW$IJk4^'8ˮܤ$IҿL!^'8$IZJۡ}+I$Vx;=y+I$Vo0_mMq%Iw4_x-r-J$I}f ~_kx+I$Fzx,Sm%I߮9^7 dV`+I$aT4_gk%I?չ_7|~"+]$I>x39Y$I>VN5vh6]$I>e GZr$IV.urhu-J$IVsw<]$I>ewZ Jf$IW4_x=w-r-J$I_Vx=wVtV$IT {z«$I-:k*OX $I7կUb*uC*I$}[xmWɪtU$I'ɪdU$I:+m*I$KTL?I-J$IS+ UI$juWū,[r.J$IG2ջxJ'EUI$k4^kXv&]L$IeZ 0~o$IZsϻr:Q%Ic'TI$iek5`,UlT$IZczxG?!-J$I+>^wOF{RSI$ik`e$I{y}^m[r-J$I[:^>[$$I6Ss*^JH%Iu2_OB% $I6k4^m(*I$me: TΜ$I҈=rwhu-J$I9^yWӅPI$i1:W.S}A%I/I&ϲ+7$I4\5`] ~i)I$ X+^֣s-zJ$IO6 $IkW.S};%Ikue3Zr.tJ$Ix}8N?є,pJ$IGT5Z7%I$gT5L¦$IV.uxZg$IV+5[r.hJ>Ve/_^?E+篿io*WKz[v浩B$}m}j7b$7K6_7_~___ 0K'2 }^7ELIku~=yfWo/ ėҿIһ_!{~ݴJ1%I?J6/įVޡ4ux)IJS'׾+_]A2O0 Np)I^/[7/H꿦'X6s$':uG~9sx_L\#I?_C'{I+%i'Fc\Dӛ_EIb<6j$)jsE11HϱL,[jo|@:Gww['4DoKAFee3S؈4tm|C+~@ǐ1i~)YMLyWc8^ƻާ{mSEzu韭$m,_V~˲+7٢$mVK'1r~Famɢ1.:JJI#kEFID~qg/I[9;ʒ6[S+1ܱqTρ$m~]W w~",v(I}CZr~$ik~iII| @҆?9YXնLi u q69ZM%i-S}g"HZ_ta/?d Uj s&| @zj"9l1Q֘~Ɨ$mVgyWӅDIZa6y _^ƴQc(Ikgg76U+1#Zv&]<7rm|N3~$i 6X֯3 eYf>Azァ$.|_^QͲtPVS+1韥3&Ik_CuUTBIZUe~K?ku_1[OebhKr6} kV@^dPSZ9 >\}$iekbh\v8(IkʆƲϞ$e1[L,[U2ջ3(I+꩕-9%i-?sgQVSs$5` \ 7fQVTEe_7Β@IZK~˜+gRV/6,r.Jz! kt$~I iZt֜ @k:rN,JZ{WLbHo2fQIZM1kbIko|Uj kg&Ϫ$VocX"6)E?IZIL1Q:I[_k'>IZQ1Q>Zǐ~.IcX+1Q鿲~n%iEXew"$+&1QK;V_s iZr.IZju'cXW$m!_#$i-ٌ`-^3,Iİe*ž$%_cX&Ds'I`ޥeIZSư?C,i9 I[hc kw[rORǰW$mV.bXӡ}'IR~@&2|]9O$i]ǰW$m!ߨY-IҚ_f V:-I/Xv&]L15XY>㒴Zǰ|{:E;IZQL1˷g\֖_/aIO j3.Ik969B$e1&@V =¾a-Iڲ2lqNVW56} oG{ThuN$iT`%wIZeth6[5fC3/Iklc oGYr-IZlk$mV.b>¡}'IklC oI3}%i:|e*B$VocMrmL.8wnfp1&xٗUi sXv&]|gٺ/Ik>Yo3[|fQ5E s{z゛$VocM5VCl\fe>x~optMV^bM-ԯ+eWnE6IZ{M1|OfkuCoI~f&I>;B9MZew$m"w3#iӵ:phY&I驕`tl,HVzacߣ-IVSi,HfjuטŰtL&IJ͞IX1B$m'3(s!j4=۲+7"$me1P\#i^`\w;(iCyogBS+1 4LCK?չ_oyWӅ3I`}4?J?=C'c}٢$m1? ̨|OprC K-_`T iZ7_~?fX&Io0CYr= ߋ-IҖ뛠1 POagτ$mV` as0z왐ׯ=g*߇-I뛠1P^䙐2YTE1I!$ } qN$i8C" '{&$ipph6[ Q=4JTc8'^4z1$gBF꩕`E0IaH3!IC<_`w<]a=4ZTbXJ]f_4Z14gB`]]I$ibh!eτ$2Շ`=lKF,GRLHҨ=r#a?.tICʞ IV=y%IC$ ){&$iZ!|Uj2]䒤a=4zڴ&8-r-nI0 Cʞ IV1L'X}$ ^ 0왐$ׯOK2[Ԓ$c˞ IK1TXr.hI^=zc$I% ){&$IQsN-L^J%IbȄ!eτ$?!|Uj?,`IQ 0왐$P+1lXv&]$G1lgB-S}a^Iz[1tgB=rC'|ClJ Cʞ IRRsf-Oϻr.XIb!eτ$)o] eb$)/PRLH~Z ]$I^ 0왐$V1'Q"$_a=ׯ]a>G2[$FaH3!IE1[r.LI~Y 0왐$~Z qR=٢$p Cʞ Ijuװp cu %IzS1gBc8?d!JbH!eτ$bH?sh6[$RaH3!Iz{TcHO8/I^ 0왐$V.bXshu->IW 0왐$V +“$ Cʞ I[zC+|Ujg2[t$^aH3!IZ9fٕtI[ Cʞ IL!W~d_2[l$^1gBbJfL/XRLHVb$$鏊a=?fW$%IC- ){&$I^-ZOTE%IҟC- ){&$I} ~d$Ib!eτ$c׸p GfI)[RLH>Vn҅$I҇C. ){&$IW-\Fwhu-"I>raH3!IZr.'E$I҇. ){&$I} h*ucp$Ib!eτ$j4^FMh$Ib!eτ$_!=٢$=驕~a?.I>~aH3!IZc`ϻr.I>aH3!I W.S}$IW 0왐$}nڷتeWn!I0 ){&$I\آ~.I>aH3!Io15lQHP Cʞ IC1[L,]$}I1ÐgB5kb8`+b$k=/չ_C2kL:]$}Y1$ÐgBǐ W$ a=_ 2k{$I_[ 0왐$}mTcX`:/IQ 0왐$}}O\ Zg>/fRLHV ZlqG0 Cʞ I74ǨHv$I^ 0왐$}8&UV٢$=_#5bu#I:b!eτ$hcd!Gt$Ő Cʞ Iԯ!vh6[đ$O1dÐgBt<-S}!LI:b؆!eτ$Ű w9o$IU 0왐$Ye9iLn$IGW 0왐$e1tR=ɂ$=#*ˮܤ5,oRLHE ^~?cX#I:b!eτ$x{j"p>a?.HaH3!I:Zc3=y@#I:b!eτ$[z8a*uC8#I:b(!eτ$PG[v&[$1ÐgBZPG'/=颌$=uԯrh6[$aH3!IZI1 1C: ){&$I_GC:߻-HS 0왐$V~-] e*$iUŰCʞ I꺏a1_OZ$ /C; ){&$I_OC;Y]$I+vRLH2x~bx!eτ$i=r;ouhu-HY 0왐$V~]] 󮜧 -C< ){&$Im] L?IL![d$aH3!IZy0Yv&]\$aH3!IZw1/IO1[\$aH3!IZQG1[T$aH3!I@1OTI&=mԯn*>[L$maH3!IN:Xr-HS 0왐$mdEb؇!eτ$i[=y :z-HU 0왐$me1iʙ4F1ÐgBv1>[4$maH3!I`e9`~tDb!eτ$i-S` U~lDb !eτ$iõrS-r.H6[L0왐$m߇EI$I-RLHS+1 la?.H_L0왐$mVyWӅI择=L.mJ]-H_L0왐$Q/Xr-H(RLH}LOIŔCʞ I8bJXC"$ibJ!eτ$iZcJXe*g$ibZ!eτ$i]i`}$ibZ!eτ$iZrS,SN>$IS ){&$ICvSWɂ$ibz!eτ$iZ9`=b$ibz!eτ$i̖>^C%I,RLH"ߡ}!I"`H3!IV~m^LyWI4Cʞ I-Si8 T ITCʞ ITp|]I5$IS ){&$ITp\r1L5$I ){&$Ikb8l1C^L0왐$V.2t!C( RLHw:2_0[Đ$bʀ!eτ$I_Yr-^Hbڀ!eτ$I?tJ& $G1ugB{ޕ:ޡlB=$2ǘ:֡S%Io-RLHEL_>[$)+RLH<_B>_0]$_)=$[Tb \UTE IF`H3!IOk4ϳM8!IOi=$F>GG-NHb*!eτ$I꩕J>^0[$WTCʞ I~YsL%yW IPL'0왐$Mz ǘJ$R`H3!I[Ŕ疩\g$R`H3!IқkuS "$Io,RLH|1~` I{i=$VV~23%IQL-0왐$-rS {EI[L-0왐$ݵ:8[0& ƨz@hM 4&dPYOt$^꒙X_ĊssFUea.H$I$\o8"uY&b{$I$Iz[MX7Cb,[aC-F$I$ϵ{7b,[Q H$I$v`W0{>*˲5ѮmF$I$ YH] Nj$I$I][eٚϚz[$I$I?kOc}TϊFlMA 2I$I5mf@l7RekbH$I$t]. pH] 8v_l9$I$IM8r.Pr$I$IRcێeٚCjŶ#I$IzyێeٚCk#I$Izl˷M8z.Cl=$I$R=ppH] 85I$IS~8~.<~$I$IR/{=)$uY&X^r[$I$IP7 Xb ,[p4Cc$I$I[AGېeٚczې$I$IjMX7b+,[ptCH$I$myWn7b+,[pl؊$I$Ij{7b;,[p /CH$I$mv_fBlGRekNbSlG$I$i+}ߕp"%I] 8Ŗ$I$ItSa1}N$%˲5ԮmI$I$y,߲?RlKRekNj-I$IOON(&˲5֮I$I$v_vSIlM uI$I$y,_<R$uY&5=I$I5p=I] 8Nu-J$I$v_z3-JlM=%I$ItS<g۔eٚelS$I$iͻrb,[pNئ$I$IRk=SlUReke(WUI$I%z@K[eٚԮJ$I$-5=v%uY&` v%I$IR);Ė%uY&`)ueI$I%4[v-KlMb 1,I$It޾ ۖeٚ%i ƶ%I$I~w$-˲52)-I$It|I0uI] XyWnc$I$Iӗ`ib뒺,[DuK$I$y,߲:,Ql_Rek!/I$ItR|A)0˲5Kծ-L$I$v/_vH-LlMRc}-L$I$vXƤ.,Pb$I$Il?pKۘeٚE@L$I$5=V&uY&`V&I$ItS);v&uY&`rۙ$I$I:dܦqXΤ.A{!3I$Itڽ{0k[eٚxUli$I${C8EliRekVcSli$I$c`Eb[,[*CmM$I$}CczmMlMڴ ck$I$Ii˷ k[eٚzM$I$v^rՉMlM}ߕI$IFI] XNI$Iʥؒ.U08I$IC}VI] XNumN$I$v^zmNlM=6'I$I~tS<֧` [eٚelu$I$)kޕP +[eٚ[$I$Iv^G/;Tv'uY&` ^r۝$I$I{X4lAlwRek6aSlw$I$?}ߕA6"<˲5[h-O$I$M7C4lEl{Rek]k۞$I$I}7[vx-mOlM 1=I$I=K!I] ؚval}$I$~w١&>˲53)>I$Ik˗ ۟eٚ-w6?I$Iݏ`b,[ICr[$I$I}2 [eٚ {-P$I7ݔ:99 f6(uY&`ڵ J$I}x,A˲5[|mP$Ikecز .l]0BI$I1 B˲57ԩ=ۡ$I$I|MЁ.`}l$I$mCSvĖ(uY&C-Q$Im4mzNĖ(uY&큈%I$IZv]v^Ķ(uY&'Z%I$IZw =mQlM@W:Ŷ(I$Iz%=@gbk,[Лv=bl$I$PC/&F˲5=j$(I$IҺ-;@b{,[Щ%I$IZOM~ ]-RlM@"%I$IZG^ -RlM@>)I$Iky)I˲5=k&6)I$IҲ1;@b,[еN*%I$IZf` RlM!JI$ItS<֧@ ݋RlMrۥ$I$Ijޕ0 .[@Xc$I$i9{ua]& *LI$I< %L˲5NeJ$It WlRek`El$I$P+?uJ] uJ$It|?)uY& 1NI$IN_&X˲5|Cl$I$v\r>(Y˲5|]۬$I$I'.mVlM79YI$I~]GpxJ] sJ$Icv>'Z˲5|P Gl$I$v\z>-[˲5Cl$I$yOA8r.p C-W$Iw6=D[eٚcsl$I$ڽq!8v.p8/CmW$I{X#p8J] :Ŷ+I$Iy,_҃#pPJ] J$Izm?VlRek8vcl$Iޚ-;,ۯeٚ`J$Izj)-XlM}W,I$IPC"pK] H:,I$IP.=۰eٚgޕ؆%I$I[mXlMG4i.K$IZ.=G[eٚ!bI$InJ#XlM'0؎%I$I[XlM79cI$IҖj߲ p|%K] 4^r[$I$i+ciĖ,uY&ԮmY$ILlRek8`Hl˒$I5׾z{,uY&el͒$I6[zN*f˲5Pck$I$-='۳eٚN]۳$I$imzӋYlMg0)gI$IҚEK] <]-Z$Iڽn!8آ.p>umZ$I^rmZlMg۴$I$iM7c}NvV-uY&+_c$I$-v[v+j˲5W{$jI$Ik:e:b,[k$c$I$-׃9`b,[ ujĖ-I$IZJ޶ ,BlRekXyeK$ItSa);۶eٚd(mK$Iݼ+ Xض.ض%I$Ikor-uY&eyUlݒ$Isim-uY&[$I$cʼn[lM 4Իؾ%I$IPʼn[lMԮ-\$It|i2.uY&cl$IS4ݔeKi"6.uY&+_c$I$yWn\K] `:6.I$I:f6OV.uY&ekV.I$I:VP,[lRekXNA%I$Iݿŋ\lM۹$I$M7c}Jb Ė.uY&el$IC]Ka*Ė.uY&u[$I$ڽk! X֥./Cm]$Ig/`=b[,[ ujS.I$IhwkzV%v˲5K{@%vI$IGj߬1;tۻeٚVh(K$I'*`b,[Yb$I$\?-;L۽eٚ֯=۽$I${C~K] `^r[$I$?~>@[eٚ6bS{%}I$IR/-=@۾eٚc}l$IwMlGlRekؘ\/I$I6[zh6%~˲5lK{%~I$I'-;4ۿeٚe(WK$IRz_lM4)I$Iy,_҃I1H] `z#$I$a1=$#eٚk.1H$I-;ceٚ6l1H$IҶnJm#`b,[}ߕ1 H$Ivw6;eٚ6nS$Ig>8 uY&k`8 I$I۫q@lM@$IS,=]@lMx@$ItS<֧t"˲5td(1H$Iw6=݈@lMc$I$vY,;@lM}yU$Ig/1H] 3C51H$I%=݉@lMix I$Ik?'˲5]#$I$y,߲CЧ.Щ>ƈ I$Ig5K9@bL,[@$I$izn~Ř uY& u1A$I~(~eٚ6m $I=f١[ Rek`.1.H$Ije.$I$iYM7c}J2@3K $Iڽe!AlM4Xcd$Ie+u1M Rek?^rc$I$y?bl,[5ԩ=`$I$5=MRek61:H$IynJ}=;lWRek݆:x!I$Ik˗1bH] hĈ!I$Ioo?1bH] jvƘ!I$In˷pQ1fH] c$IR}bbԐ,[}Wƨ!I$InޕP1jH] O$I$<CRekڃ<1nH$Iҿke ϊqClM|P@O$IڽaAb䐺,[#$I$tS<֧p1vH] C%I$IkeCClM<;$I$^'%F˲5pH/CC$IRc eٚ8NA?$I$],˲5phA?$I$tS~ab,[G1A$I$'DlMB{ (FI$I[N!F˲5p 큠I$I$mv~Sv8K.cc$I-:?<R%Rekd:b4$I=_pB1H] {D$IZnJ 'eٚ8\x"I$iab<,[69I$Ik=ʆ}SElMPbD$ICˆ|sElMPQ$I$y,_LbL,[2>I$Ikh?l8S.9M"FI$IKn˷l8U.Y 1FI$IKm)geٚ85I$IKlޕl8W. uqE$IjvyXY.bd$Iڽ]1H] E,E$Iju<B"uY&!I$In)uS2,F.Rek`I|E$I9kteC;"uY&ds.$IUӕ KeٚX\"I$cφuElM,PQ0$INY+(F˲5D큣a$I$P!`b,[5c$I$y,`b,[K5)I$In)Ǖ KeٚX5FI$Il?Իl(Xe. uQF$IұjoyXg.ͻr$Icc6,]3Rek` r#$ICʆp5FlMC4$ItS<֧dXk.Zb$It}[ 1H] c$IuʆoFlMFI$Ik?lXu.M"I$IYlXw. 1I$I?7ݔ:9V.F˲5wk<$I޼+ 1H] M#$Ijr:Dl@=Rek`+ڃM1H$Ij?[ceٚ،N}$Ikd3#uY&6!FI$ߦR>%3#uY&6g(1H$I}JeGlMl<$Ijba`kb,[[2$Iz [#eٚؤN$I>%6* ˲5U$I>1* ˲5iCQH$IvXC1($uY&6m1 I$IۭJb qHlMl]$I]͆aqHlMlP$I5] OHlM=#$IڽW Ѓ.@/ڃQ1I$Iۨw HlMt!"I$iM7c}J_nh$uY&zH$IZw힫lIFRek'Xc4$I[j?)zzeٚPb<$I8%I$vT*F.}WH%I$yWn!?JlMCb$It].<q1VI] ަ=c$It}S X%uY&xVV$IjLeC'oeٚ]b$I>tS<֧db,[O{P++I$caJlM>Xc$I_Wj?)6x.2$I5>2x.0ԩ=c$I|IL>$,˲5Ǵb̒$I~p Ę%uY&\ƨ%I$y,ҡQKlMqXbԒ$I~tSjG**.2$IPaωqKlMICbܒ$I]7#eٚz#$I^tb䒺,[t].b$I|͆G#.˲5 1.I$o)uS:<p1zI] =$Izoޕlhpb,[P$Is~6C#eٚ|K$I6>8.6ԩ=#$Iz \`RekxL$I=5ݔ:)8ä.G2$IK>t8(b ,[<$ICvT6p1I] e(W1I$iz ObRek#qL$I[mO^cRekz$I~0q8&uY&8\H&I}ʆ@/F2˲5 1F2I$mv&Is6ݔ:)Xߤ.4M$IjޕlX`Y7c+[,P$ItڽLm(K5ko?[,8'IcOOPr/qH'uɗ%IN~w0zq nSt$I:F?~:4muRWzcN$In?l`zcU/5*L"F;I$*fCvRWƒZ 1F;I$y:?Sb$IgkfCҾ#M ,ItJmJ.Ve˗nTO$Ius1[yRrVhS{`-F=I$vR:hNCQO"gyQO$I;)X/oگ^$s$IF uqOyZ`^g$Il`ܙz=2)?I$4X6D-틟1Jwk$IOfcO&lk$IY XOTr@_n1 J$i?lh`^r㠴^~`ڃn1J$[)ضy1J_8蒫$IRߵ7>%[Lm4_rWc,$Iv/R6$hz}Xc,$Iv[5M-CI~jwf}i_ QZ}~PIUXi_ 1QZ}?Х%I~@@:Ř(:?? 2FEI?J!2c}QQ$iy"7ƴ?egICˆ Zs7o<$I[bbtV׼+4_)&OG:$i+a>C}y4FIiy9[s֑$I0G05FIic u1R$i{܅ { *FJiyj8)IgC'cUҿ_׳N{p.FJI3Jx7)?xR$iOaz3 +Zp gc$I{^eC 'c|z'c$IZvͰV6{'cԔѼ+*k$I*.fC\5] _x ^6_ƨ)IڽE *-y'|H/cԔ$IZ^>fC |t` 29%IS(^cޔt<֧o>͙1vJ$-x39^\4m$IҢf1\_ ^?%IΛ786{#S'ÿڃv1J$ěaT~}0#tQT$_͆8>X*y,_'$IikO\c}J8y>Sy9cjX*It&K2Q3΢}5RI!S,EUO-;Si3i$Iǯj6Y uj_RqUp\3g#INU{*H>{clޝ{XU%I~ gKhYe$I],/?-_U$1`ڗb}wK2]%I׼+KKzK~ $Ia˅X_?k~*XIϷc6tϨ3kԋqV$}ߕٰkѾ0ݔ#:χPc$IXMfi:l|r:jh+I]͆ X+o;XN1J$v'cآAp$s%IycԖ$I[= a} MړI>k-I~w0݃i_Lyrc$Ib?h~|^.cT|iyWn=:H.I~G@}0/=g%IvO0ԩ}XfyIٽ1KވK{u+_vh‚`^r#$IB?~R4񅀱>מ˷W?OfS$i'r<Оϗq^(M&gAl|I~am@7I;&tf$IZ[NN/A$vg#Hixj $i c6usCڃ$IZrX:_cIC}L6re| I$\{y>5It]6iw?HS7]4;cItg3GIt=<٦ Iq$I:vMX ڃ$I:fXe1!c}%$IұjO:e1 *>$Ih?Իl8Nu($I!%݀`}|L!I~ p4C*$I!j줛.c}+$IgnJ}\Mڃ$ILf-I u-$IGETTz_H>k8b|!I]mg1C$yO p&8C$yWnMଆ:$Osng6[|!I~$}8XM`eڃ1$I}5m9PD~E`q$I}4>֮=H7f$Im)u?d#،y,_If-ds|<"Ilؚ\$$mP`:M">*$i{n<f}|\"I616o($I|M7;c}M$IZoMse(W$IlޕlPD5]@ozH^7mlkPG)$568E7ݔ:):U$IZvXe:*$-۴ $Il?Իlo:M">b$iYcn`dcI~ 2>j$i{jM _HtR=5٦ *>v$ͻrmVPe|"Iy˅>g}|"Iy1ۤxe|#Ii+_ c| #Ijc}J7'>=Ht]6%>aS|#Ikϴ'ݔ f|,#IqzmFP@f|4#Iq%݈8xFcp`F|6os|L#InJmd2Fô]pDCrHC?ycm$I\>f '2F}W '3)>$M7$d8f|#Iw6\8N1$Ioo.mI7cwq$Iok}pVAHG6!>֑$M7c}J6=H7[XI]{?)DX`g|#I?.<XNuz$Iy,_ҍ%{{$IP e|#I꽗\79>$tSjuh|?^w6$XN$Ǧr6t`U@z~Xh|$I5X>AnJn Z{4>$myWn  I\觛$I[m} !Cڃ$ikcnlC|L$IZ>&/lT{@4>*$moً>59>.$mvK *>6$yWn{:0i.ё$isOm}||$IZk>f/tf($im}ߕ;ݙ#ItSj{^S{4>N$yWnu:6)>N$\EIc%Iқz@($IKےf$-x^ 0$IKi?ԻE~it].#'Iҹ|C|$I:w>&/6C$I|M_>Os4ݔ^ix\PS7m 6)>$\>`}|%I:U/? gQ#)Iұ+_c>Rc6ݔ:)}1hSc5[" 3)>${M_zzN~-/ ?_]3m^k?{^_;kc*IҡU U|"ګ/\N}I:KW._rϗ6kS;qIt~ɕ_O?a{LJGU_P؆8I78ŀq+hG\f/8l?~J/ծD$37Q>qw~?  q$}o%/>˽i3_V'I= `|&j* `!ڹ%1H^\~އ5΃RM_{#}Q8y?mWڗڿ?sx=<űES43{Q8y,_OmN=IҟTMb p>_l퟉/gznc$wxf[b pLg.u=/h#$Wy8ܶhr[Ȝ#%7;OE H"I}c38?_8 )}ߕq$'o'1GOopp|g8HZ퍙N pX<_\7㲿 Ci1D]b i~_9^Ϟ~mN^kOcx8 ?Zy#o Eܿ~ky=oC!8|;r-phq䐤^|^“zgkΦ *Of/5SLe[6)Guh/~"[OQCT) ཆzG I~俎+CiQC]ױs%iC}#$m')~=Qvڹ"ݜً#W2)E.} ?sM?w6ܟ|Y‡ZBε uE-$icPX!-N {qcBKXőBZT/Cf~k(q]:sD)EG IZgbP5ҢkO V7V؏/?{=?hH!Ii.ޢrX;CqBZUoo)>^_~~AYԇZ{q/o38NHk?ۙ]Ck#ŗӿuc%$iyxNXQBDު=PG IZnf/b5j<ӿ{{=1B'?:E78FHzxP!m:_ޢ=`IZNhwq-] GIZN>&/X:ͯ_uPJ;SANS{#d/J@/vV5te(Wq|7mbmc!8:Hq˅{wL%y5Kk?lMs Igtν҇k_mqtoHx*y, =+GI:\ E蜧K@jS$09BW|O+qtϷ]btIH uj_$}4io>ܔGIyzGIx{w\űA+_5e$yH 1 :{׺~1, jWy@:jL?{~O҇w6{Q:7Ի86H:b@jSp$MS=ً Э+adN_2g86Hҟ{}p /~fP:mwk\'Mysx_:O~H 1 ̛]t$@{7|^<y_:o~H uc$f^{H_<ͻrGIgȯ.)m?ԻE蛧eW_E$O^,{1q_!9]^rI[nޕEqWC0C iM-EkW:yH@ZHX w Ij}~!Y{.Y7Ի8VHPmmkڃqt^r-N?i8ZHPwk])G In)ս~G x!iCryt]%[L"6T{` [o2{҉k-tQy"6 Ϙz Iu=  Il?lP.!阵{:EF/mPﲵVNPǯ-lP!iͻr}wxU3$#x/1CA ucC7]XQCk }w+qjwt!iek# tNks5$mֳxCc>z]OkG|ߕqܐ|G!iy8NqܐѦRbJG 16/\#4m>.z|P\ıC{j!iz|C;$'?/H} 2].&]=$m8 29tSyg!icP!w>pLC8~Hp͸5 :CүE[,"8Зc#Hp( /pc`B;{1D҆%{ 8>1DnJm#]4> eph6~j˷lCG~8NqOOb8\qD҆s pJqDPEp 8"iõ/dG1i.q$y8!ȗu<đDPp4 /cWbwq,ڗ}#R(,rGI5^rG| 8#I uEOm}mq<^ÿ?Bu8p68Hp>k 2(6+_?~GI}'{ 8!hM7:|g7))6\OpB8Hj˷|@"_bǝt]."i5}sw6+6.c8y,_"i5}s06C74튲8H`!!,Һ18őEK}ߕql֙o [҆kk5pvX"P^*qtڛj83jͻrQ,Ar_$ml,P\EZG 206T[XWj]!,ܓ]yE`֒6ڲ8HP=ٚXyq[C)#X?'myzX\QFZf `q:QF҆`ޛВE#MxYi$mTWH#-+?ړ]u%kZDZFZFXdK[Ҷr5!JC}ce dړ6'jhGcٓtSjVC ZB?ׯ) *8V\{Z&[kѮ5#tC8b}q$5CR~(VOIhs!9i1X߮][Xy,_#&[28H{=jG0JRGYB B !t`-ؙ4͗|nJ[w `J gu#&I:ƨ^cf w`RG+w4?cboBݞzۓyA4ޘ4YPϒzTTKJp^?~{^I0FW)ێyH_u@:): 4ܬAarn['Ĭ0H*7ajYT͓ `b밨!I+9pWC['pHҀZ!07nZЏ/Z'T.nHҀ{Iq L 9rE4^R8o}vy.HZO)\N*4g:+[7!uRL^}I`fYmI˕YROfF RN0u$i@n}f$w=aVoO YJ$ w-QY@V-wqSKZ'l^D (=pUMp:ifnUMNX,lb_M('G2f'I'l _u` -:77/Ccir?'(ͽr24O*ir?{| 2\6O>rzj!Yp&%oc$K,'Ň /zJ42ܵ|.w$!QY&:Բ~YNO_V-ؿZvijYB`rnKj!p^^J8uXᗤodBJq]_Be 6l~@ZQ )7!^Y&?O)\a/Gb_asK=/U>3npypLcm;oOWnZ]|l~8:,Lc+wUG$žǷ2G =pUft4ʛz38Mr7u1T۴L$ž$0 V/QyZo"Gg_=ggSHâ4ʛd=pE+ KCim(W LEI̾ա2\64NL|Pk:|ӐoB,oNM`쭧VM3 ؾpG`DhIfHC9 28XZOsh.ޞ TuHSWތ0C:ir'[܅֛@-wy0lVqʛ|s>ibsy0 pYx:v 7(c:̓FSL@}@c?te=r[odpob_EЕIZա4ꄹ7c01_Im5aW_#: ԡz^`2rk J?<.nPP.:L4vV&P./]0Q)P*by0M)nP8@uX:L49PW堶6`=e40snN_ ̓ x_7E%u.꧕<Nc&TlSY!rn[y%%hڎQߩ.g @-,G2aA7%%,Fe>˖nVuH϶xΖBux]y8{r.r7s>PƔuU?UƖv[vq|r'p:x-ж/oe;t?*@-?o>VN>`^Y؎?PT=/e``Yc*7!Je`^J``R wr(wu(\0^'lǤu:|^uX!7ꭃBAgr. , ^`R\a*/yP`XVO)\ᬎnr=0۱lΣ_WM`ƵkXe1]WzV=Vn(&TlǸiHz&lU.xIrl0a:nEy0M)e\PtC]cayfd7~E .n$S WS `pyZA?!}Y!`b{_b/SSb7R\XLI*7_?Oj%r? ϔe*&"N_2@cn) ] L| /`[kwAl㭼)թUl(:>s73N[/f+ž:>I7_ XC^~*In'zo^ wwVu}xnd:>_WnS)֓-wqSO_Y$?LNß.{p^_EI_P >!{밨Sǫҗ$ek=R쏺 @`rns?H}?lMI?U?\e/ܘ_K/:U^R8oR`rtpWhR`RSy.[ 8l}_P}byʃ6p0 ukr{Iq%aQK $:258:,m[ WmzO)\8Uz<p"e%:vط8|pz04rpz0DR]4 8:,ǽpzʊuzrn[W߄X].\)yapW^mXiA`(R4]4:,T[? KNy.[? ΪN//]I~TS-wq`xr.^R8o}30L uw媀7+W4uwo)žNnջo N*wqF`R8Sggj7p[o-/]?;{JMYY .nX`RY7 &e97#¹ `r.v2\a"0 geqpwVh}ϞRj~UY`ek}.+6p{[Ň/#wNrEANM{b_Eoʂ/mU_b{ u0.>~1e:M_G٢NrA ?_E?l/)޷c:=O5?N'|Oc?^e֓):-ܶ|_)[)yI_Nǟ@b_{^>wV!h=ACOUaQއUkwkVOo]h>i?{k'z :,ZO):>rZ/f/u^~e]*ΪN'מRj t8]|l0~JguX4_DYANA +.n/+%:}>r./&*/]6Vzb`rˊu|Zz05e:]>͞Rjp4۾X[0I.V)b?V^p`Hey: 0B:>r#~6:,Fy.4+u`R*mA+~=0IIN{ʁi4tZ=/e`s.>4 XӶzIq:p*&X9`(]K uZ[_AcJ^:p<p$ u[?KN_k.>44Ϊ N]k_c]|4^R\<#"e7uZ\eQx]ܘ?r.`R_R8:f"MJ^:ST^]z#&ë\|-í E|sTON3kȹMbN/k,nOsTK7HqmBekLW&'XE `ZRsntK 繋 ?/e&֔+;.>6OFaQ5^Jqmyb0)ޛYEy0\) uW:;+W ' SINJ͖#`}rHyp:)O)\]v[tqd4R\aQup<8Kk-'b uVOV8w`'~s.4tجg)e.]:z+KN4OL>/uYNJI ߹_C̶_⺿:* +|rSu[Jq uZUW  0ה*' Y1)WN0)[&5LN밨S|zJʅY_2\n?`rMKi~HZAHqm_d/)o?4V5ONkJjN"/]؇_Y`k}i+@[ߑXV"w4R~HWo?;);MK6Y:,ꔢ1V.~<0-eҿ=V>..KK3n]n~08}S/w^/`8?WVJCv4,_V5ѿ[d ma*W] o &%U\$Pck[XUnkSvZ0:U_oz?_M_ ~I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$_{oIENDB`PK !mMMword/media/image6.svgPK !fqqword/media/image7.pngPNG  IHDRV78IDAT8c|$Ā , F* #<}Q%KNJIENDB`PK !p4_4_word/media/image8.pngPNG  IHDRAsRGBgAMA a pHYs;;̶^IDATx^ ]BXV ! "ȀQw&1@~nuWH ۴`xQ3f"!+2 $!!!$!!u9'tt=Y vg߿nW8T>n[>t>KgYg*݋1}"?ᥫW>T*q'[=n}+9](wk_t=6Voys~-fçj>ti˘~^Z3l<籷N5aeߝ>_> \֏]E8,<~1;+VcW7ާʘ^ߋ'Wן|1~2;~tOczÇׯ9d៕t=oyO?1t ./j_ 7<|+%wƁ+^1SF^kV 12yC~-qe5P}mS%\e>o}`3+ ev{Mmj+q{{F?8|j|ƨvXx7tr5sW=l|*H%+yNv]]ܻ~>.+SAV=mjLqۻίWRgOЭ{WV]EcCg-?,,}"o]u2Gs1W{;.LTÝv`7? "Xr/ձ".HuH\6-Wc7I؆˪A~1]IU8De~:$_~|6Ւա i?sóT+{~:$poWG<\+G_[rt$V7G?e:$v?y߭y_9~X_ޚ#}yc_^>Y۟^GU$M㏯>%g2'$=Rp<%-?Vt39@l1}I1/I7#ĵӷUt EN?[}KisXXÃ$qW#Ga8>%WvvIꙟ*c]zq3/t.Io9KU}K&st8M۳9Շ$m#G؎Ř(mW\#l7<%i9f,qV?.I?]}Ƿ$<;}V˓!Wޒ!? },rzN-IQrv%R}pKRaM7<%)bpzЖ91}O-IQsW$EnN>%)z蕜~#<:e^V}TKY޹7oxLKYY5Ǵ$piwiI:I+y#Zjp_>%,oo1X}+ccY-GYo>%isPwWɒ9pczv,I#fYq,I#dӅX<;}`]RQ,I,{oJQ,I#$R컒ӏTÒth9/aI:W˓#X5G$}f,I#fq2|D+I#-o>~%s`/>|%IG$1}]+Iz[ywlTNmǮ$eZtؕ$}e1d+I1GΪcȕ$s,Z̆W}Jq5P>p%I8GΚ>n%I#gdVsXVr,XΎ\}J}Dw{Ř~$=n1>f%I7W>OZ}Jn>? @TǼ"W'W@DqVtZ~-%?_}JN#,sgǫ$-G")')Շ$=Gv?zD*Ij(yU'G"r8X%Ir`.cUԷ<;}z`8~%?_}J'إWV9+[>t1WT9+eL_[}J6#>z1WW.,-$is9meZ}$is9m%ϫ>N%ImZΆO+yZ}J6#۴8^P}J6#Rf)G$i; U>J%IO WNz7 QIvs`ӮVϟ>H%IM[cTؤkνKQIvs`I2WW&1}M!*I~l9L!*I~l"/>B%IM)9p*IMywD@?cOG$i7I6W7$.G6a9>@%IʝyT@o<Ř~$.Gz[Հ%V@o7$>Gzz˜~$6Gz?}rߪ>>%I.Spve$>? @/~sz`V@/<~><%I^?zd~ NIReq2|DӋOIsy>EN$>GzY2/><%I^J>Z}xJv#,rzr^_}xJv#%WOIý'ڔ1]Z=0><%IOЋ#$^p#$^$)x Is8HR@@/GI#8HR@@/@b@/<%I^$)x IsGI #8HR@@/GI#8HR@@/Gz~Ȏ6Gzq9Ћ#$^$)x IsGI #8HR@@/@V'8HRJa6}#$m}. O6q<|62?WN'Mlh IÏ-gGO>@x:}#$m}~.6.<\=>%I;$}vXwOIyf9HRrՒ_>@bV?$)f%_?}GIXZg鋧O5 I*+O5 I!7Ǽ>.$)ReL_3}GI V[gtj!*IzeL4LiOHR'r@MSO4 I ^{kD@_x|y$)H9>П#$hyipݷ恓Iӧ6c1 Im~.}`C$)D_4}`s$iǯ̎,sPp0$m2K'6k^U{J6[_X^< _ݵ9sG6@vrkν)pgMaGIneL3}`$iyL`.GIb9=w9HvZ}k_<9/l< %WkVIRVo>XڃUԧ~O/#$m2;gv@6[ÿ>[~J>`n9Hv@6UߦO- I[xæO- I+pq@ԽMXe}(ԥ|9;zX.;HRWNWgӅǬ$Qt@L~@[kO+ĴiV99gr8|I$>#$?$s 9H随LR8$[}7v I7 g#$ToX^< g#$=GIzt-tiӅ$cg.? I卵~md I2,wd I;}.szWNJT+$GI>_$m-#GIzߘ>$@Mi,rt|'< %WkcI_X$!ʇ?%i+yS@!6g#CwO@8,<`qt(-@!TSg#}/N<8l~mS9H`o>GI{TN8Ota`Z{HKYloM79OfK3L:8lƿ.b2%@0}0<cK:ʘ~da1%Xf0%Z%ϛ>pIYN:}`2>9](yZ{K7KϞ>ֿ_Xrn>I-gGO>IZ i1xO#_ZyaK'/I_-s0}*l3%>z\eK#ny/ITziӅ$i]釧&=~_eyӧΖ/I|Ύ_eKңrc{`KUr g/IOQSӧb3%t1n9>2%1x@\ƿ$U5'b2%>k@<ƿ$uoLVeӅ$J?=}Z ~$LeL+aKRe6|I\@ ƿ$o>ۧ,/I(|AӧvTS eK*'L[_6Yzr|O./I.N\ _6r>{]ƿ$m8}wavsPpX$=ӧKv*L_؞zƿ$m7^9 X/I[ỦO0l/Im5\=}`IA9}3%i7]G3}`IM%ν91%i/>9ƿ$?I͘tjQ*ItszIXӫkRI RLeo>П/I.[?f4@_ƿ$h>`4@_ƿ$)? ?.'Lg8- 7O41/6%)NezD@.<\=@%I;鷮}ѹ>KRg3}/I*ykwj/I Vӧ<ۦO51%)lhT@ʼn/I[o8Mk8=_bV疳'Ok8=_撇ϟ>pz.W+NIҎ+t[5G$io>p:ƿ$ŭw/.= 'Nᅗ[?dd2?>p:ƿ$m}2O>p:ƿ$._ 6}tI[ӫ8|1%)pyxrLOl8 3BʃS2K'NKR,3}tI@3_bg43%)v?0%)l?͌I@3_bg43%)v?͌I@4%)j?㿌wkNI3hfKR;fƿ$/I3hfKR;fƿ$/I3h6KI@3_bg43%)v?͌I@3_bg43%)v?aKR،-I @3_bg43%)v?ڃS;fƿ$/I3hfKR;f_"g43%)v?͌I@n7%)n?͌I@3_bg43%)v?͌I@3_bg43%)v?aKR،-I @3_bg4[g43%)v?͌I@3_bg43%)v?͌I@3_bg4g7fƿ$?5fƿ$/I3hfKR;fƿ$/I3hfKR4[:fƿ$z1$>fƿ$/I3hfKR;fƿ$/I3hfKR;fƿ$|vt/Iq3hfKRgƿ$/I3h60%)h?͌I@3_bg43%)v?͌I@3_bgl=ƿ$4[E^_{pJv@3_bg43%)v?͌I@3_bg43%)v?͌I@3_bgl/Iq3hfKR;fƿ$/I3hfKR;fƿ$/I3hfKR;fhKRԌ4[>;oxcS#fƿ$/I3hfKR;fƿ$/I3hfKR;fƿ$|643%)v?͌I@3_bg43%)v?͌I@3_bg43%)v?͌I@3_bg4 kNI3h4%)t?͌I@_6fƿ$/I3hfKR;fƿ$/I3hVa4%)n?͌I@3_bg43%)v?͌I@3_bg43%)v?͌I@3_bg43%)v?፵$i43%)v?͖ƿ$/I3h _f4>G_f43%)v?͌I@43%)v?͌I@3_bg43%)v?͌I@3_bg43%)v?͌I@3_bg4[Uo=8%I/I3hfKR-I @3_bgl=ƿ$/I3hfKRpY9@3_bgЬE_f43%)v?͌I@3_bg43%)v?͌I@3_bg43%)v?͌I@3_bgl=K$>fƿ$/I3h4%)t?͌I@_6fƿ$/I3hfKR;f%w7fƿ$/wOl8_g2%)x?2%)x?I @+_g2%)x?I @/SZ<Vƿ$/I3heKRZ-I@+_gj=WK_f2%)x?I @2Z=.I@+_g2%)x?I @+_g*/I3heKRZ<Vƿ$/I3h%Ug2%)x?I @+_gZ;Vƿ$zƿ$E/I3hUt2%)x?I @+_g2%)x?I @+_g2%)x?I @+_gZ$i>G_f2%)x?I @+_gZ;Vƿ$z/I@+_g*9=2%)ve>p:ƿ$/Ic2%)x?I @+_ghfKR8%I/I3heKR43%)v?ʉ/Ic2%)x?I @+_b43%)v?aKR;2%)x?ʘ;fƿ$/I3hfKR2%)x?I/I3hfKR?I @+_gj=KNSZ<Vƿ$/I3heKRZ<Vƿ$/I3heKRZ]1%)v?Z/Iq3hUrz/I3heKRZ<Vƿ$/I3heKRZ<Vƿ$/I3heKRZ<V_TNI3heKRZ<Vƿ$/I3heKRZ<Vƿ$/I3heKRZ]1%)v?l_gj=ƿ$/I3hƿ$E/I3heKRZ<Vƿ$/I3heKRZ2KLl8_wh%E)I}?I @+_ghfKR}/I3heKR,3}tI Z<Vƿ$/I3heKRZ<Vƿ$/I3h%NI+t1%)v?͌I /I3hu}ƿ$/I43%)x~Vƿ$43%)v?VR)I;=}t'C^ڃS?y’kjNI3h1$tB*' ENW{Jn2Kӧbvw_WjYIң;nCV3oY1+Izt qW$gpf%2g%_>%2goĒaI:;Òt(yNjbI:ʘ.MCoِkbI?esjcIrLǒo=%i38X1}{,IA+cCY)WokeIڛpUfIڇxbL?]}4KY)KՇ$x{%Y}U@+㏫=%ilqqOX=x[v+jpIv?lPӋkqIf?l"㒴؂ӳjrIF?lr>(Oi#sId?l}wa sIP~v?}U"v朻H(FTXAi%!`aos"ZCz=""b+D 3,),#w2s3[H ϝ:꒴[Iź$mT%KUJ\T`ȝ+͟.%h2`49]KґfjRP^$J]Kfk%.%P3`o]K! 0?YehS\^Km0aڥϫ]K͝<^;Ջ|IZ;0n]KC+9,_6IԤxqb_̝m&kd))|v/i3`ʴp~_fZ"ĒOk#@e+)~6$V?L& ήI3T/ Z5(40;ISo7Y4w`6S .w`kCAt5zO{`4<`4o5Fn(ܹ~8HaJ IT̓7)S&+8kcBd,.I I&kBxg] ƅ#J7FJԆ?mڅsgjCx?!J gv]6P%jCenO+96B$m~?p̴9 IS^;I 9h&{jDұ6UI8t2MzKFL1׆\`1Y^PRYmH:JڀtdX*ٻH<ژt+y%_Fg8 I&NÇkGR=H/?I񻵡#i]):&?Ts %ԍ?U&څs,)^]?,?0u"Ēj#HŌ`j][1`#np}>ĤM{S YxnI+ii~aU+)\p[m77՝N?}0yV8z̀n辳K],դծw7i&N{àpfۺn<ۮ/vc`5)<59k|}Timݏv3<fmɏ?qZgypYI}ݰ|M<87}etWv[/m?}mI}`#K۟TY uՍkx߅䰻Guއ{xlk~g~ssX+HaIENDB`PK ! word/media/image9.svgPK!F word/theme/theme1.xmlYkG?,{W9H+)Nl'&VRrFc%9R(z롔h!MJiNbB|ޛ߼"lC[vZɶ`}/4lq&1ls۟vlF1-;|U,2_ vLa,ƄF. # N+RV "vĜ*U{{ſ39cz(UÅPaGbsajܲ:#r2mah%gWBfo!M*JÕNүoz^W[Sb ]g9 l4 n3+?^ԆPt7n(i6R5œ tɭUnW1;FxuJck8"/ʹ)_<ѐ"k) åJ_㨖(؂ # lcHOєByӧ>{vڛr; r~_Zߚ,Wosw/߾zަ`PuXH$6hXI B8` RƀPCߙ taޜiC: # OjӮ\+kY,Ǧ5/fSȤ F Ɛ[rL 4=DH>)aḓd4 hJvP$27llR߅:R M*!x8A=C953.<@L2fK]fnHGR&& $쒉hj0&"Du@O ?8}پ/Ґ9@̌$y1&mi)M1::@ =18#Lx2lM X2hXĴ=?_K fzU\4&<_U2WU%cJ&-^#%}3F9{L=LQ_ Z=dXNE 0SLYYSDᤆEdBt\^qQdVOԫ^. H!YL'Q5/ vv!, >ZxE\N]'a$MH)_z=gL}xZ# 7D& Cqy_K5z4L"kz:g 5>$Tc2S- CLfRƻ LM%(uSnJ]%,}zS_Y'Z|JX/WwIl m!aǵJYmvjf/8NjBջ6'uN9^P+{^$FPw*So7zNbyPK!!(customXml/item1.xml $( A0EBz.XVMrSMҎoo \NSV;h  E8hG@+E` fXJhf:HkNc$5's,EQ2?GaPpkw]y> S[pBg5xGX]/(E[_ PK! CaU(customXml/itemProps1.xml $( j0 Cu.%+qJb`WqCl)c>NⓐU3e7vnCtWJBup7UN"D%*N|ѲdP6=jyC=0o ~,L 080rTFMy#bB?`Z*bxG,7fzpkZ:i7x1 Q|PK! Nh6'word/numbering.xmlzYH6ٗb"&V!BGY5Y^s6Q+KT0-_į_RQD?}GT~T_ FQԕ_MS@\= G;xqD{T!I*G5Q/E{NpAR5Q k Oԯ? $կ?~csC$9$HC;2*Q/ X%~W\^OyCL\"YLpQ΄__U4/#_fD[.'o̭~tQьZUC=>gW hg\WR3i 9_#R&65?ܡ_OR|> !N 'aVA8wRQ r!FL( Exm;T)~ ƽ^JȔeR! rG֯_xLN1G4Ns˨oɵ-H1'+ zSr1 E?"_*YfG61.a JY<#xE4ȵ~Zd_Z(LK]·h*^[~3HcǏN;yNEU?f}lz*~#$o`25Eqd%2tUGY7YGz~ /9?yw>Ẹ6N62?)71!v{yGNr-ήշv}j nEmSnYRh5s_Sejk- xoYn׻uoĔ9x$=64>1%Jvix."-G|%w[}mJ6kbcu:6_~^æuײ3vn1#'Ȟ[3W|xt"Slۘ[5/${ez{lxwOy{*-Zݽ2^Q8b)_rd+Ǡ1;e n#ڐ2 \T#7@,̟ o/BkO6>..]޼k7yzt\V6E|Hlbpݤsktm5HBjI(so|:,z6ǀOgv .OOY牦OW]yQ98C߾3]w2ɞЁJp9w-YxlGP=:;x."/pƉ{])؁bmse }:ufUk𑅞ucXӻOnӛc;ˤ5Ά% H{"#]^j74>Y>%yU絿U: ݳR8R||e~xeŔR^n<@35C=fxOW>_8nP4bۯ㍀g {I3ziʷEp _i':)tH6a\|ժ׵:_A꺟CWJZIoyKK旣ܭPO*{{b+~pGσPM^D<7hNjbݵN3.FH>;Zͩ)-2ƀ*?,}:ӎ.&7{B!ݹjN3zκ]jAKb܏v:&|Evjt^e䚛_g&xކeV>]H|1"rvM;f/-ýFwfg>$k,]QZl˓+a^+XpEWmG4ur,' Kia?)tRj6yΎ O=4@IBՖiiwUk$LlۢUPw fK{0{Z6;dw).ɌDO:z $5,U[Eݞ(0ԯE I T؜P źvKE௯M怍/|\lB/ϥ'@2tkX_GUC-煈es㜗F@G=n49ӃgW1"i^R\Z2 2pl8g%bAh_91DU,A([&M0;mيg(B2}&v-;1ϚJA^1[l]We[#k]Ǐٍ2QARpiRji K˲,][]^[ *L@mgPh'EX v/pLfΩ-$qC ӮJk{bG0'"+۬eˆΙq^x4O^y\//`TZq@hq89H.EN)5#ۄ!CoK#Pfj >rpVF镎~1Xڏ9"eFR V!6cXnH8_.J ߑ ex-+dH _AFYcX~IK8㳙żJ 0Ȱy6Z߸$!&;B jJ»'w;jzrf7bqFZZg &R023{(rE "_0&ƨزu0bp B Qu @aaעa)Eb 6wJi p^.U⩍>۽qd&.!bvY4Z/X[u{%fby&,7&IWO7Hֶnϯ fk}r+q ,bdedgXtyVx74*?aV{w3 >V8"ƕ$}1B_/JܘC`I6>fc r˹b ,;5 {-'Xq|cN|2B}FfS[ªmJA:+aP(u+X%4O?|_rGerEܱ'ZnDadgq9g?!uWmr O^I0Q e8nlgQMX >bL 1-hiq{#`޴Wmd%0FaĈ+&}rP8gXM^O%c,V|lzr \f!/!q%j :F^~0w*_GR?t3SLX$i~E[rRjl50Ifxy5+?O„uWr(n>0jÍHAo1)Ԃ!dS0%<ѥYo2"!P,`dCHei˼c]+R뗿G'HGZ\ |H?qv9<8X6h(}p==q,Ee,Q Iw!ݽXh0Rr7qF {=as([ꀕ#H>C@~Dx*Gn(r(r% 0@WP'!>~jum A~Q|EMՅ`fSۤPmYL3NVtlrfXW|@ 3Gc W;,m .6 |8SCJ/PG:V82CKv1&O052mni^+>O >hny"5pNiũ3}A̔k".RƮ-C kN&rOL%VdAFcW cK4É|fݤIZ% sM3/ן" ;>|8an`;pĄp7Ճ,)ҚC-,&vjպzbFɰy#?pT]{+QQ-4&EfsOD ,}W>-VQ[{ou:I|'.u}`DyY5NR>Ҁ"[)rehɝV.gp.ug5Y87NXa7=G|uW)gu]a;FXLFNtL[ByYT%̅6]X(Rx˵1":Ǝ%]P6 =u?n{JR^OkMɷ S2lnҧ!l}D_]xc' #`p{?)Q4LDaqv(h%vlHqTFUiJ\EO*4<\#m DOVo;X )OVS"'n9YKA#9 |$R*+O\8 ݩ"r\`6uM[q[[3'Rm7]OIx='Ђx}+'5IAw>y3=>05NECQy{Lċݚ7x~g؏s=<0$=7 #9,z'qu\fBZ* __>U{a AL"됩L3,YH!8]!M -ݟdva0W3]c[ʧQ4#XjB *ΔH K 8%kP^ 'IdZTTX%J=N4{ J'GdC"̉Jx :xVJ`mfsuz aRX/&q#3ãؘ`' $\᱖aWղu+IvBm$:4yVAOayy& ʢZ:nNX67̉gLIݗ;O)=C%gAG:[ 00DLB|MwWI:~#WUϾDGw.;O$BpaCORpvȳԍotبT)Vꌦo1i`:]8l"18S$֨7\HcvXsɩK{]..\, xEri݊xWoXkİ_٦XEAÈe\KavxE+Փ,([2:߱o +/0) uE&b4q;"v*؍IRFHզ5K83vԎǧsb5Vn DXdW u8gzO國t tسv[G1KaVhq{l|^E1e˂4q]1!Pߌo@ 8sDL YI+Eh姪=-_52HҥF3TJHe6h'k2鎀΋owե]4䥲;^eORv;VDC[2:`*\A; VH87Wdl :I1 LZ["lWW ktQ{nd5+N=̭BulH߼ UU4/wCv $pT\ھ, G m(!mP4r:Ȁj*Wk FƃZy'+QCV !7)c2kHaq:AB)&zhU)DnTkzOSBI6;ݱS-N$:zf Q3 nMY,LZӂ07jtdڀeGpv;f R2j[CGO?](IYu2$Y ;usL~DO0 'hܭ%yOG-{ jp,O.Qe~zHgMwvDߋ藺v~Bё$/Z',wiqCh# G1syxL~(i>77b{=g/S]Vg8I#?7}F&ofﰶߏOFckm M M|'odnT`` Ч>AN=(T<7Ψ&OaIA[DN9H}YtvK qG6FcB_ys$bsBÆ|wQ# :nNp aAj® ka*kWI#5D7K^HKc^)D aC79uTk~bݼzq|\er2ae DpC:)Yz?RߔQnͭ8=@LP2 qve]L"L2\8ɤ TbmuTJ O B0bGsςj_ ^kI’o{RwWQgL/v|'d 5Oz]ۚHsVZYh QFлlZ}nam3olSoDH5 [9c\j|lEALˌptVG""L鱼kVrj%-`=n "/z%!M'YAFʑwcy+3m=;-uN)O^ Jixk Q--~_9w O]|]V0%y(]$S zoZ'PW$(}5WYT\)/N">e]WNh|:Kx')u#'RS՞;l(J@y[ ŇU7v;h1IzU*! 0"D`t{ovw @># aLNK/#K(hwZ*?xY!6V1[s3 N0&~wpsW71v,?o ߣks"&QbZO|E}lyQ7:ooN<"Ã簫~ʳI䐞o5֩ _EMV (ӔNhl'V] 2 ~yݶџ^9\&2IvM¸rdNtQ-ɢ1yw3HT -yuG|<-)E2%[T7Q  GrerxZI>ՠa"q'Jw #ٜQEg[>&n'iQ?F`08=/*Af ~/ɬSY#I~DO*& l[:dj%k+DQ'F~ VTP{s}֋eG+zBS 0t}+$c˧|BwVvFl]c'r壒 ]Zʆ_}|9OqSC?s03尿!Asr>2[LPLEުxTp:eDn|qwyJ{ho!~!_x9"[uF4ùhblh^k ?EH %~"DUq1Y<,'84A Ζ鷄̕ڒDvQOFE4u-lg%`BĜ7QV2SKB,PkI2{%@TS+-hS=lkna d}L(nϹ "dwD_Pqj7!˩@y915􊰮 ԧ@rDa"UO̤Hhj`rVgZngU4 \eE7MXzYej?lU&@g'uU2 6 K# Xofx#b;߉/qS dsv~9 Zɝ+e>;.ҵͻKyMV[;0J'sfb]bJ#bt6&p~ĭY 1CdJhD5^cK{C5K;S wpѩi:0ý=EYנ i+d_8q{20$}n3w}} 2 X1lvp/~;'-9 k|фj2)@ WF۫=V6 轊x8[4dirc E8섔5>9 1,A"ЪC"(b9#n)@v%ku揋;hSvQءڼ[)n X3ILdȨdhaMwuH| Pc=E4(a-r,}[ߙʖ.ɪڅtZc SuOyC"$,ִ~߹TUK j ovς ]sӮ~I{$qRjݔzYC(m O"/ȱ;*WI*+S\)AD|, ~^3@_Bm0)z== "މ=I n"NaNCl"s-mQnCG,$vu2 ɟ9ұBHbMH 9#hVEjgf6B\s;>>\g!]3M|*y7|h=wGzӑ a둍m4l&U6 iG|Ǘq$8%qRdDAb{M !yI)%;_ :YУ Ġ;[qLyE`3rKܳl.I_Z6[լFڒ}!lCpơ@AC7kDAYcl/9Yctӿ,3q!ȟx?PhX4+0]`-|H m8iRH""܁DO~!-EA4۩r+L}zBjwް!4m"h_qA3mA2řIEfqa)jCXႈkCןҶ˕io f+K&:ph!lZOdΧuw*f " :|1aKHBщf=aMA*sRhPx80~X g~R_L)kfnrjCQpy;籰Zl_hn̫ٴVVb)SSc"M&,ב_}Q*5}i>wȫ)iN.ҁBԖWq6!֑\CsW2\cI#o>~E/;ءWc߾rz> f7ͼgF܄CbA_Ye3bUɯfեx }E  < >U719/'  ; lfmP8$pd G/82ΐf1b2sߦA jˇrzx6*7 /kdOir L f*L}?4չBo =%|cj\Ɲ[/ŭԩkhӚa_&gt]RXgm PunW|0˚=F+PN/7+ifMb$|z>TՋ jS]VU.z,Ha>6VZuuA%''^H Pi6a3K(/(e@"M)刌4.YWJ1Bj !o [ܨaB#~FgzxD(~|wNl)P:z˂gfџh UƗ2N{)g%Z_e;>n.n"qLl:iˬkMxh Z@u$4~I銄O2whQքk|B# q JF>ιaNsxobhm^T6nc7Պ}xÎvC9-#`n)cSvb{vZWhAoMN˵(!fuvn/TCp-3zpb@bREy4z못zcyqyե׈T\Fdz9.Mic -k 0 F3y6|=Ʃl65-aah+V6Z Egs>a1blL:68Y#Χf5 i57qKk4 qfN`EHn_B" 6oL[n!*PeS Ts~6/kB+hȸٺQ7婫 C.3VZb!H[[7" $kT][EC)h^mAMIKcX䘣|(ep`N]B ح ҂n]3,3mĩu;ԃFп".)O<{!Q@3aqή춇ViDqmt(J0t#I sRH13. Q VN'ٲYgvwf(tOVKefixz2ǟ Mᅦl~!O'm ZeȞVӎX aamS?P)&qb2] QZm,Kl*.|-13E> 9vh00n<c$[SQfh]3gu$؅,12 ;rL+bvhmJܖ Qu y _"Qhl箮̲_SMvV `jQOWxۧ6>31H#9AVGv0;6O?2R>U)^ Ȏ#Ǻ W8B >$VEȋc i'Úvk 6F .o]z=Xč_(g.j`}NTj1n%;w شB[4yL&Yl@Vu1JNJ΍鯢yuZO^hyf|H [ J i0q']͊Da9t_iA7T2Kg}8F9%xG^%\%Y;7<(NT]<9%pO:39DGX}&\qycOoyQMe 9  }{!!Ƭa0NvAˑ,<>Aa4)W/A|1ç+L,/evXx=iui,S<9ȫ]j?İ ,4J6{/EQwn@,2g>gr|5llLuX`PxI09x1kw_qiv+\)VdGVTŢT=1XP/sJ=塊/kMgTVNA[.H9LSʯ݈F;*\|\M-"͟9XyĆ&.; \ͯi0.0헑gCoèhx@d5DQEf͌ 1y 5GP\J0Z}so\"Ϟf0L|;.Ԏ+ezQ4\EZnmݾu(T27%-ۑLo"qT'pR0?5ӾB2ĵqnusGھGcD!l`/1֭7S㯈iZdr>\C5ч|Mm蜜MPYJXP[.pUGtFC|K-&%>=PkIڡ F20k!Têc徴#TӗuDQӁ1~'$ȆL-hN0A,5Aa ,fK]? ̒;[(+J.e99#{}ԑ20=x9g$-,lG[)_:QζEڙ-xzOëjdz\w5JDV^FP42w+tV"πhx쯚T?Z!Tq1X#?g{֊Yw9bQӻsdp0Wzݿ,7{Sш kO]?3F`܍c=qpJTCDE76{p5 Rv\B٩4zЃV Q'k颠8JvA|ģR[33_Ykcuϊ'u6z {cR#_1=yY^4|N`͹6XO=NS2(`^Ƕ'.ę9e{ͫxmsĎR.͘a&ޑq4;GPB3WO%t2QIʭA$+c,P9lAŝ#QD|s:yyW8tJ*q6)k"*wpea_Vey",H⡢vP@vW61K)g2 A\3BE ѧgf_AH4& }}5$0)G[)ByWf29.OpTz*0hl1_+Rƥ\:d׹BzE\ȝ6 TWmQZBP?YO*Ru-2,a+FnGS$j|L̑f]ǧ U<16t}JGՇ^Ҝh> zyO=ze3r l,<6}= ~Tus_{dKbh(ȩS`=;:4`=ZnȯWH6LF ۇ'e%Z ǂ|r 0]cANMĻ=jX+g_Q?CGI\9KF5ܪ 4'ч])S7z#\('mxZTFDӺH 3Nq 2iehm&ȠفT1\Tz&:%&ldk̪u7:>V=\u@@Wi=3+LV=uxiV^^V=NYU n6CRe[.-Ofu_"ȁ9p@qc[Ĭs__hzeڶP=\0BbVm_XAo`kZ;r$R}Ϭ"4o=к9nw9N;i)]Wme|05+Wjek֎þ<58j,.*OJK]X ]v*R4ݩh-w<D{d2QHhn4' RAʕRP3E|QsNm(2<{ dU<-k $b*VΪYE~d_v/+-զ: 4/'x긃qm WbW %?W]HC?UkAӟPs.1Fj2G4zkK3:hhaaPPʟgsZGkHLT@;rb!0 :ce]tXZʼX+Q'ABYuiNkpEd`1C۝|\emч𳨌 x 4MY} *:T 驖+ U {8r8ZٽF^aGе ߈B7"!2A.]7"~4N)n) \X|CU;U+g L|7>Y ϔ m{TY0]hFc)ZnI_$Ra@ >[CvϠc5uA ؍WF0wyHm#o*|0̿U`:vn &;Ay-:_yoF"(&-ʻ So6Bl EY &z6oY)pUߙ SuL%QuWp'nKrh |UNmo*˿l rfM0a~|hg&_xiB/?ߊ/?Lo?!j/39H#˪#x__yKB?`wknW2g_%aUܗa% 9y3xU~8yz1ip;\Y<;HO4xTcDY/L>_W}Zc4_P=h0#4E՚4:G‡1#Y}q4B>wG2wspHj>OfeYnuHHڼBpdw_*4/s'V,K癁cZ:y_)hL`8ҸXA+#VZ(h-Hh}R&%| m<ъ*Y[*wn M} ;H9zW9GB{ -ya+ {/ǰ6Tv~667#Wþw#χa *aOr &&{+c^ckq]bN ~),{\E)6ĜNi@G%bUDd|6'LMr0ZCB9sQ9lݨ a5-V;{- x}c_{kM(~S֫-bxOK睰;YBޡk<@ɊWVm.J%t^썼L_*Ȱ\.bk?qs;rM.: QEBw.w3`g-sܜ07+p#m=ad=MpN|0o}Aк ,Cn7 WA9f_qLP753 įQCdh*"JC+Gmz̃Uk҃17JǸ߄ZƸ߄7m0r0?M@?),Po * H78 a_;g☽1rS3.My$7 i6[FwB{cc_\B磫(7QCxR0cu]u3F6ɫ|σސwL!TA^R7 0H/t$M aj8ģQ}N,\8uۖN!j2/B2r(΀R6/i0@#f4C[YWM(J{qv˶SHj{«9R_R9ٖ:r$,Y:tiy`&;ss88{ ^po7T+bK '9[+w:;VI=-e'JO9M拒,̣WL3 Wpn}3 Sh*/Ӑm|0ŀ4zsr"@0*7wyetXJdLeb +Fg61w7J\ܺqqecL/:ikc1KV2#ϥrz<ܲ^ bۢp\s7Q)6tKJ~.xrD:S*uqZTt6̮r/ UNd=MPaT"TVa I$xQodTt<_;  :PM}7Ku}Z!8, xRc ފWAk  Zat(@F{H5zN(_4/F )FVr<ʫ /ZPیrRiYUR.;l2GG}ƴ!}fg~w8 kҳC*9s.áE4܊cL&2fA)~+m: -8Cq!iaF &еȍF $Rih~]]"wj37):99n>Uµ. fΙE(9+<`A[iF)rrJI/ % +(ygS8ā2s|EeY UVWT2LPrTcy.r004 T23fsr̔Q{ s#̏ qpi8 okDnmYHɸx4atݠMb P!AۂGzAb&Gk<@_5i[]&57pNXuA:9M qG.`3a 8S\Vҿ3s|SLPxqҥ~ \JN.|8a5I!ՙu.6݊Fb3|tC}42(EχrK4DcMwtTGÔ gIVqAfPdt熩h+SBm;v%lcT;\IJ "9W¥瘟~y-YD(Ai1bjM/ *bSzzŲ8H> Њy@@.9ɩ<;4љ_ht:gJB\u$&^>"rA!ZU`y@kXt*jc rB:UIq`nPS{n`SЬY0(e] ?ˎ٦>݁if].x,/)57ZɆ}%WSN\XNr@ [k1I }jװ~#;Ҙe*4G!sR_1}owtdB BL@cI0eQ.@!iT2ic8 fJbN69Os)=;Kix >R,FZ*nu(il ,>M9'&m, =țR ڼҰ<i9`rZ39`L'0W$#oo}p,C\CP?W>pr\zIo\)C⡕CL\d[ps}KQKg ;8~ӠKQlw-:ACP<ӆՒH P)L!šO{&'ohy}HKTZ]qqg~EI1̹vìF}@m<ՓF-| cpIWQ_Roi>XV`2%@qhvxj 2^/Z)9ž!rX k\8\WcZ r?߉DF!vnI dr VјƷO! bt@ve+/L3gF~<Rӱ r%: ..[DP+t3SKzn|vM0 7~O(&@.}oz7㊞Y 8ci_.Qq a(LT7\9YVr6pVX\$„x+†e]s8R%zs8XsKu{+C 9N!re9sljܯu&i YLPJ9YthY.;j~,NL㨒LAb9^H^B,l$!cTy-vTZAPktSpi74@fR?H  % ; qڠ*꧰`Qr44! ʚ!KP>syd3P ;SH ^-؀Y$8&xk٭e7NMF%k4G, 5R)6ՍXiy򞵖<&؃)FP#@4@5&no@HCRۏŏeNMzGgk"o++?5آW0!;@ExV[Jqռ=e7*qFehća?79XC AkTĭ蚞+$9aK0ԑIGggLt4!=Hs*xJv(PWX`|_G_:Se"$:2h4!`!֨8M,Vr šB5L )dw};;\|}5mlYIҧ]p-DMN`xćbN,11:؝C "ns {&D3)VX@Aղѡ]!,{>[ 8|Rt>ޜf-:W;͘Ũ֔~`2B$UY2YxHSӣN_g`61*P;,˘`#I-8NCf$;G)E;9^\ p|-B )Q,Q`)k`ʰZ߄PBe8VL|Ee#Wg:^a6Mq=W;F[Gx\r(q~;ȳㅻÍ,4X9WQ3*f >J6Z L3FA weIu;'!Їxh:R5ۊ8za k ˆ}R0(ɠ,llK x3(^ĝ͉p[mn0^4C6uLPv*;vljoyrм؄eL9:hU@yiכ8>5SFwRHy`;a%9&j3|a #0^c^v$x~5O9 K {K]҉ (&֮g[d$fQHSV=;;~xVN Ar ϰM _I~[k$\Yzw)5kyi.\]DMfOQJa kM*n!6֖J1f҇Hȓ.#z#XF9_hT%T'{ 8k/x?O$-0AN,h<-b52LX'VK(}~‚n.&L''nI{EOaisk`;,In%ӸLuhh/Y5/,=@jflڪ9t!]E=aC(VyWz1&UqP! ZvdgC+E]ͳ,@o4Z*9?k_ֵ*`.TdDPDdP~]vVDdf 1JKsW2h 淩wTs_J2a|t|#|ܮ% oރX >)g䏍ӔfGĎdGL Vn|~al3>t˞OԣSX p1A\>:$Wrp,pj7K`8kqtz"IFݏҗK^^rd>?y,D! '>\0 'a:E ;bdž &cԑׇ{'g{e{9$WVD+f=sޕ4BG^nFuS C 7zlbSЋʧn6d6% N"b?IN#[B39W%b[vr,41mJ0J=YO"5f7NG-$gH$>C oi]nQ/|ainW%l%nyؼ<rM*yIBdZBw hF$)K3X1iq"(u$@eGHȱdn9Zqǝcr[ҝRuܕ'5IYx`+Ic1!H5y^)JpÆ ;!G%=%1?k9gnb/3Ģ6S6ZEޤa-]O M=Tey`ao80GnE:H] ^AbC ĥ'^ 4iB㇌E$yRZ~"ĉhb1I JR3m*@HU4-0"y hSq_>a`Bj5diMc,C~,ipegSGcN$GB$0$ORW`U !"ž@|f'I9+cSO&0l':D2"l2o|"]DyaˍpLSύm(<ΣƠGq06eu=1.圑bٯI各LZ yFfc*MY813NrֱX ^#SeFZj@TMS>nxHDWAV1EO;}oG9U"DʡR˜TI;sbtP#@k 0 idmit!A8i- nl{'=ji>aHMe3PT=8GZd(* p4Z.z0̴@,Iwe!7T)y!XmZ,"/a)G `!4eRIK& &<,XB' Zho|#W,l2nL}|iDmgC+srUA>9cAe50-_*a#&GhIg6Bʿ9쩜9TӯF> _)2݇!潛CdF4e0+.5nI^*V/`G^-dSڬ(B[xYo1 H'^>01%s p)'–,yKjbδ$w'5eD9lw;ρEPt :듞 lU8 ޝLX'Һ|fA3ͦ))?Sqc;Z)!eM6y%ϢFhNi=_7 &C5E v#%,cd%oݷ @* L0ujdxrZ4eV>XxLY,ɎH`)B0HWɰ; `K'9F)]<,W(J {\Pܰt/I xY#@kO~BvABMk嵔 `,ÕyrOM5p)TBa'IvdVK=1,]s#I>Q|f(_sxVބ+٩gVP}e9D:r@ /SxA=y]-N* [^!^8-jc*)%\,&=eɇ<)^*㛡^>$䇘lG9?,t  Ei{~Ey˹$D=>JGH'N)dM HlziBz:ƌ>-N1rph=R~$ xJg>gԍ|qku\v ~Ƒ+$Qf u'ROJ S5ȶt|_:q咝[>Rgs^#S"W/_bSy:0dzw}8|s"X(;MrzfmϾ'g AgCxo kL yؖ^g? 3Dr"G%P^L7>flbsp4"O r/=|_B+2CEuAP#8~Yftp\ŕj݄>fC\|KGD_)W ~w g<3a"|݋{CV8pDnx"WcīCs8SfR4'pnNP,vm`v7Wug| \9)m)r6g-Sǻ*qT%7TX<<6R)'fblq<{qknd&ylWTȫv۟\,ڊ=$)[x~5/m EO=)oUj1jepZFqT)+t@VebR|̟bBO3F""xAy6ǥ̨eN,xdC~C'alPu|RUmI\X ldgomlZET 4OVz /T 'nCCd= tMUq,w|>\>$A=r#zB̧NV OQ_)ۅ »)jRP:cNx CFQ=)\|3)sm)7xGME{R*CSzŷqD7mr}.Is uHΠǡƠpb3>rgq?x1FX(愱iщ!ݖѻ";c/2a86= z2Ϛz4xiZzߗȿSb3[H +'y W 1"\BQ{1ao9EDdyҢWXq`][*36+1se$z hF_fX.wh7/rCZ}n5ݛKK.>G%X'6ŕm|,¥dwpx3gP~KUNxZ3+}DNzdHcmw![pvРB/B ~i)a/ca"Xas'g@#$8  wP}&h8(وhnx|*-5S9UuA۶ H- Xֱ GʦEҽsAA2P0P*НR}(sDmW Ͷ⨉=aI)= t?8<ζ<Ǯ aD3s0 Zz33Ggsx/Φިomz.9KFKB-ݫ @̬k|UE{Xc,X +x>*YuW]s?&&~hJX:D^s~"yq](Rs!XwQ𣙾?[TyP,[dM;WwAsw(]P&|خ\0ԥUejЦ͊(`iSev)A1κzT"/h5U >KO3n1ˁԢRg=nZtmbixR>CfP6J~}N9j$-P%BUuT$f&P~g]JemAsK)' {/_Y}Gv }g<~偒e02sČO:^jOdq/(f-k gbucDkolԕDplN T35{uSž!4=>n—d\ g`7ۜ.NQ[nsϙPToo$"dqPfυ o(8"џ+Z:w'XB-)SkB)(p (!8Jh_ِBc`CIEKQ*tv׷Ehll SS_\ǖۿJp54-nF:QK/*1"_a9Q^6X-U sMf"P t:giɇqүYlh !34c3$>hds$n{QB=[j+:ծӗ}c@ +NUo+n<C40T͎'+sH|>;E(w'ٕe:@VWE{8f} m-֩EHas(cƽ2/2j6/ZM{1쁓A^GSf!gҚu/Da+qPYm>Zl >uƻ-![u \3ol#YΗtѝNv OMlc۬ڝCqEN=G To"dȴLv.ts|Pfuɰ=|)7)[] `ǎw#J2'L7G^,PWemSTa`s[ݟ\g`(g73>ݕEs͞u1ŷ1f h_ ]qM.9|Anr6 VXE:q/WZl{LtVu\!.$xscy9U-aZzQQo'%Zrv }]l(gG״wOzggnNBtq('Jlꇆ{^Y`vYY}Q́v!`(bNq:=2)geV}xj[t,;pNbu--Z2Ԡ_BB\ꕮ˞a-5`h "CŨJgTѴ+2,4>Fv́>lo۔5lk(g"z! Tȥtf0 g5%vAZqɏLupNq۪L} hpj9iR ' ]z*wFAoBn^e£$a5xLl8Ċ⹀8S7aE&ZXB( Za6D"ᜠL߇ʺKL8Oޥf-青m]{7FOUt ;ИX{PX'kqeF֝BmzV1} (պX?]r&~> 816L)ay-ōlW*gzH֒tyH@;3rso@6l(+. <@%OKX@+%lRĤhzTP~+sE2Kv}%w6_˭܉j5|.">K|(.LCf‰z5mT,t͚]f2Dr9mAlŰ1Z5 "Ϧ]hׄ eKyY_>7c89%V%z/<.z\> -rkזL%9[}nuۥuLN}7v4)j{Q)پ}9/lĆfJ"˅?󻮫 qކ˸Dx9m8v,o="hȁ}76nknՙ o IPZOٶbCݥi_ϯb,M_r҃O{Iz[%C@5(=p&~=>gz6w-0]r]3˜?~;ao἖5·{ jA`)jP=qL[q?K)HuHOmc.}=e}RG>3?}Q1Cy6o巚I LXҟi7՜}Tf[ENCJ*mȻ9yT)wI,ۯ"kC=Q㤭a'e}a=܉d">WY=j+(0{˳÷ 俆sG.U+w-M\N?j6IHR_RWB}2,;R`ϛ&AuNx!e W 56b$B ~nW 0OsW(V4$n(~IRu#8AxK9䗆aP(q͵Sqb U%jN8 nW Z^I~ R_{, 7j _B&*,R8^&Sɮz=]-d6]^_ t~Xyյ*{ycX&]*Z}u'87ŊEM>9(v4TRS<^ݾY/'YQzSBԕY0x!?S>t^Ac/wYF(/} kRkp<3NN hM_0l1~N]yQ:m>J~[j)vY >i3*FrǮcQzm{܉ D R{Kݧ$B#=*ph:[chfr&EG9-RD}6}&"^ߓIRh6(Z\mGf]>itu&qIU!mԡ^ryS\]ka&yW>QSjȁ^qX!Aa"Ud^"*j[،j:t?w_jtV33MJ3cԸҀ paEJ^eָӤ&]Mvp@#kDF <и&1lԛ=OS״n{=Bt:@S}5;Drܝ6`d+vlZoH4iS.P(g/%eSN=Ӧ0.;Zg 8rhL-٩!Q.5KmfxG"6}uH8i&9UoI4m |$,qӵ:*k4e 8Jz7j9BJԆkͩ1 7pj3Vm Lצ36Pf& w.cp"nw50THQu5 N 7epdSǑBjp]s8mlBC4npkݎ3p4Y8G'P 9b{p>A/ !e$q'g!8ٸbm .įGJ8d-63,4t}"@z`%~79h51= ڼr}J+hw iefǻ>мNAQ60Ρ5֛117t(WɈGXUѝŖpD `v8.pK/mR{;=H)ZŪ+GQe5`q讆rsVGePnT|ɳ^> Ň=PX2ֵ6W6':vSq?7OU6|[IDս5D2vpƌ/(jBs~DM2T(8dTn [GkGxg&Ӂ Mvg&=>"WL/nU 1 Vd-[`p()+A$OCگhᝧr(L& 6k:oK}#^复Nc$Wi%EoYkŎDuM.19]#_Hϛͮv`W b͗™@:f7"7L7pr$Kh 9k|tkNKn9+ w'0& lwJ\9c攔9:׌ƯHЏQVC uh#co^J;>Zr&hЗ/)1yܑ~&=BN.ؔv#?gOaF9u(MM?G3޸'?ڔOB)/s>+ 9йR[\?_ox y"'G倫Ewc֩:KugI8 ;# fN돠WqWoK-"Vս?׿@cWVEj~~Fw ~gYq}~H{%wn=UUsރ{~??x@tF^C/q h3 á=rZ' rxƧر<:Ӝ(G_ԛtitߖ{1{O TrWA=Pcy-2=ͼ۾׷6!#P+͟ǽ ;)ƞ%~@2|#nzGטL;c%UC끿U^*uO(JNױ&t{G#ٕALre_dQw.?%>|$}AS|EnOfrY pQٱ|iO\*aqE9x"tR+|V0" FNnUbz{2\iWܟ/(-LR(Gsq'>I#Vi]r$:?64'@ aB2>*L^!_ٺ.$yO>.FMDI;O#>z3@+6+7 \} I 勸[g7O}USDF@n/L}UABd6[ss?X٭%in<o.hP!qMNUn df]N_SrŊ?N<ݏpwi*Kv=4vu]aI$YWI7jǷES䙞 K ɮ'17#V Ve7D:/;{ ~z~}Kn=*ǔW?e}{)!P@jzM~v\`Q鎡PQ 6oZ|a_@>~nT\lH'k["}ڜӃoN+{~P{A=4mڙcru}K8m!>u*_}e"3͔HeN?LܮӋU}s}tCc7#O=kc{I\Em3Zwxw}fh|/E[igo0mT52:_;=CDykD6 %׫øYY+tW\wˬCѶ:;oNXy#Pg irbw#aZׁd^ɚIUCIYA3<*\d ?p멢>#@f⚪UpPC&.I2/gL`!|M>a 9oMX\tk,ٍ;%AwȧHPZЎrYB.)e+6. /ÄKHC(;M2ҥq9pUv@ ~j_<̙:ƑEZZ0l -5 KAd%5J;1S.ɜe3!"l H%m$,~Zd GϜbH h pJWM'u"+#HS)lԌYn5&*#sf'9 "VWI@ ;Kd:*)z+FhϹX,ݷC>SsfKtQ G/-ؑpgL d&X0T t&X;¢%īd!I[m9pwd/0 y7l*8o$]F`9sPT;J51!噫3!o rFʜ=nzVe!69o#EW[|lPǎ<ݣuD DxipUTI{7sOh^=Dtk֮_ НhF2:=^x~9+*+^QsRLgVk H24+cm=B#oEa92AnŒ'gS,v-xbqd>_Ϧ["a/=7ěJr9q47겜ܯjX8k#$bJ W#3q7Y| PČ5'%A1*{WV}~νth snIrM霗 b"1eH2szOv65QrO>Ύq;]"NyY'KJLӜ@,,[s@:DLz-ܧWu ՠ8g:tYd2|fA3bx^f2Zσ]?,^GAvq wY `:b4=q#Ϗl(e7v,K+q'/ @gi֛gVH)qGWSqEـrm}Ykrm3u, OE&mg}zgë6dQ/YXra ~<)RgSz;.K?PNo!HQo{yD6(ĿٸfqDӈU×b-7ؗw~GWVLZ&4x1 <"cTzZ;kY=v%gbutp"U밾dA_*vJ4w(l#@fǶAw Ӊ{=U1H뤖4z[ko}gt; ZoDF'4.}O* +ܵӆv}c@ݕQ#FJ$f$O$"0|CH*j}K%c*T6D/k ž|`0׬[N!v@2!%FJr(10].J{)چZDuy= ŦeK{")Y~WlEumӃ̯[RdVZaqˑF=!QxdTov{[OVWjY\tIʥ@lRL^F̝iknk/9c goOeXt"C#mwf#amozuT%hܠܺ!0C< k-x5RMER]8%\*kK16b}kw!m& <[m +/u_(v3Nj(3ZL%=W eM`M4 OR{Gk$cёαXykwS6.at֤izqky?69]fLϢyNb5*\oB/le8w7rZGKC:w-s՜Q\}1U.ǫ2ו:oqEf\7A|03}ju1Z1һ?O6K"ps6AdoҀIy深 ;noیSz)iT*W?0ѢQrMLd:߰"sf`kPiJֵlT:B?bBّHj,d1:)7/ǯ;M` [p Fwλ}r YxTH660r3^؄ 7X !CWu |ȣqߣG\ZbWa ,t?Q6J\1D5Aq.ér9w5XqGkK8 wҬ]Q|E946\F,ߦAJڥm𢺃8Żg<94 h|cdCk':|/5c6]^Ik!v1l$R#k"Z'l;ȜƸ`GlB`t߁_}9TL#.E0{}b Gj rlN bj Wבz)rwi)*(R&-agz3Fw x- he; ~9a$Ym.`iqԦR?.=Rb}]V`/o/ M3_Vg1c4Ѥhp n MFPYl&%٧`;MӪudA},:] 8/9{/Q̮#뛘j4Glk ho \*_G9D7379 t\k)yșzPO`pH鬯\s>}11`f&wPEi Sq c |R, 㐳kVG0aKO4Qzh9Y=+M2轧8sG3fm:.IX8KZp vzbBwh]Qhx;9v¯¬`5M# T GGtk?O%nz~⽈lcm*ӄB{ԗh/9LNxf?:F\Bиzdo{_k7tqx0gPNn0J]){5c䈓5Lg0uO݊ѳkc%;ԾG\%ꊶ7*r)Y l#U!i:!N]7SxЋ X1`a5E<]|ZY2ä@b̅u <$V(߰WSK8:TЛb߿YXStm#K;`i|JM!\'W׌i[mi4(ymEVpzUXb^B9SUޫ!D]Gŷ8sI XhkQS>?D hEvi_K N.jȓ{26sE`3uqru9&?t[q@ht8h0}?)@C!v2} <sUs9dZ7EJք 1`:d5.vF hv"X8iS3R(PWo>ȘEaSm#֥~) N4ϟگ)q萎4cDz``q@*(=}xlloŊd|px[(: fEDDw}̧W@5ڠJ'F|xA ^&cJ9:r1} ]hUNvoVc=lS䦭hI3^Pz7!gܢ+y3.>Whtٰgrc{;̀ Ƶ)n'K1RmO̺序]7$PRnXPPMm1Q~g͚az aG)J6"]*G&>yȗkV%l Hkt1- L 3wkHfIhj2<@yy{9.f v-:R< (06W%G3bO*b\[4;_8Ԍ68z%LX).A?bG `vΤk~zKhHGa3(8 ɧ/JU9fkmM T1`~!CBNv>m}Gٺa~d`&H%vÇV%#e!JDQ :9S9/F3T +oov+7M3+ɫw!}K7S8"I<)4,̫#8Qrt(f#i rtBTN {D{h`96#{PI5g53ƙ\H"|1mwv,E5?NNxEgBrGG&^HG OuuIZk].\Љ;T{Ռ.>N/5i H,2!g H%4PlW2D꺵f8A(NUTM#&4Fju:s$kefD}A]3=2 8.=a,@Swѻ}oXr@ۘHtB[8(nԘ1z̄ϒ)|`S |:#ۈ?3 )VcG<._z,yvI,G{ʷ)>[7儇; dʉkC3KlD 2U9e$I[>[Z@UHOz1Vѯ T"ē6Q& ʇ'QS{!ٜD" R Q*:V-,{n䢮Kbiѷl~r$?qޡNRx0Ro&IE:R;J荡[ij8(,WAG82eedʣ"O A*rʩ/>w8g.Ɇ7X>QD+$hP \"Ώ>eA1^{;%Qr{¦Pk#-sD\x {V$v(v*.9ӏt|#=CQCcv+A"UϟqVIDnMm_ Y{X::穵[(مH'eOP~y(-e7ֿ< uC3]$?*wc\kP~e1e"AԧaUǪa쳿5Չg|CP_"Owa,ʈn$Ya'>\ o6]z3["KӘ!Wo-Owش*&r#5v +sJ'o{/NϕlM/N%^gJK-FR`^_Ea.^题,clPLj L bPq˿06t;D}l@u#`IPWzg8]<>mI+ II+Mخm'1~Nv¤^a6u]NŘ$E ԲX!yC T*_ ^c$2ߓJ s{*|j|]Dv ~?BUz;žn mŚ&H*o众Z06ǻ4EFs}z v[ଔ S_iX_[)M(^8UPr4{ Mv ~3{D1Ll-KՀ pR V8Fq-NǺҾF3sKyW7L*/t\eƏJ#0T?G2'JΆnG>uݔq*>^Yi3T. |XE;ZO7h*pLRyA}8{OQH#ځYe YE]qҋ/noc'Z C/?RP[TA5B'zƪkmkq[OxRC }ׄLj,8ATz{.XO:.qQfheG<FlJY7cpʶS</8?~OC UPv@ #lU1Լwl֞4:kGQ;tc=\w)ff6=DsXF/+eyW?Fd gUlT[MD J g/y43Ы<جtS9yOpcr㡗T(PH!^&IyV {y&V-4ϜԃvUIR+6癒0\|Tذ 6=S4DpI]B8,2j+~?^ɱ⡄(D&b m6ϏR/ݤ]XF}I2@H'nZϣ -p+s*^ϔO *4ᓻOX>|y8v/ (.C2k8ahqÉYDEMIb&(=S[_ +i6G$PW2q]SҪ_m 3t_\*~VdhGd`HO$ZMqy6[dp]&q4Ey<:.KI ^>W;z dY5i'3v|U:}{ EqfBVVɡܥ#ڴ,-[ҽf~UKJIXfWb{=ͥ: NSz,A}0bh#+s7JfA؇(tF;J^[iLՆطC<A' T4ew`J]X4^T Sj1պ\x6=Tj[:Dzt,hjzЄ;wCiUuN,!Wfj%ޙa<{]ۣiGz1;.LQȅu芔Y=r8i5"Qn9|q>X;jfܿ0¹r05rXoS(f3+ ^ˈdzNw;qRcV*|yZz㋆v3o(*f1*-`-rhcU#5Ar=*SKп%Y@6N%Nۜ}` $DbxU]4fXّ C-V#X:*?X~@<"~6`u$l:t]*1UqiJ CEv7<W$u>YI'&}lc$@G$DtAan'pWo6:ށ Bp}3ܱ|UfrR= K$\ΊE6 e4Ug&[ ]t "R$sxCexrQj}([ZD<(2 [[cYi@/ æ_FI ~#;ҭ22}|_RDҷ!jDF Pf3?32b ,5XKMF!x8o\:&W[""9YT+Q& tYNkU9#'Wշܮdn0ѯ5rϢ%+, 8l(|r :Ū+!VmkO|ڿM(RŦu6_&;Qҗ(f1AiB߮aBqa8 |iXp,ʼ}ȗ֢V "|KK$K$nyEj>8 +䎒0@)zF]Yk9 l* mR@upz:1<MLjҔ6vd>l(v,{ɩJ2D=@nejYV;PW<_(OdKoXOӒ M3j}[B9C왃X/TGMj"5bb zIZk}m.6K{{:8]\Y͓1-K;h4$Pн(. 9sfU `QofBv tXkF-؛z2w(~[0cl ~])=2iH%@!kge0hޮ#w-k;bAK#eq7b.F^ o,$*T9_R:*S axk=C" ͬ6 a&5nSe!w0$虳^~ |x`‰Ҵaz,jQ0ro*A#-8Qu^vj3$CC897I̹ǞQRږ +RcZ/ _3@ҾE%-2QRE"י+E)umՇ6F%!s QEæW"X-,@[r &b!zҐO*qSTOau,cP::(j#}J0&8Su.zqy6 ʇG{UI z֕;Y5QDyPw=/i'pB &K.Vw_l/&~gWrfӻk}?)~XwշY'=oz+=i>Eg?׊3p垴4kd۫Z-6g` Dٍ#-12u;d(-D4b5W <ٜZx F0 aTOX 8QRCtզ0em? uX EW٭VP!492L>A#Jn4NMxKU633 <6֒*З)OYD)N?j#wXHeM,L`$+KhSyݚ ?+{=Gj,B(dE(k&V8i UNh@q,iZwpU^ANBpBF ɘYzFx!FGHkBZ#h@1G#NbÙRb<H'n/_㹬p*J*YڒcCs%%K<-ۗlZu:kf@Ë!1˩&RFi詘ֺkE sg9ٺ+/IF J̴] 3+۠d bMR_M Gxlԉw(GM@=c=41Hl@V8/i" SBW2D oF+GXSnB# JA`y&XwDeU=WCz6B~AOe5FAyrΦ%;6ac`c9ņa~q%j0r*Lz>4G'ҝOTpPio]FrSɺ10a\ j~t=@jV&)3i^SdHE_ee)Kz>ؙ=aE~VJ)mШ*O0}9(&V [ala*`ErF0SjVznevf3#axR`L;[zL V?̱E:XQ!0cXuTfQ ޝM!iC})U?敦U?lrx76s7F%2Z$ܐ!ȃc.:!;[)vc*ϧ\Ye/wZ6S)v Q^ e̐ 'eM!(dZ?kPG04cyl $&m(2<f| Ym(ce/BG-C6d`r!0skHpBP P[!k}P-r3~ˆ.m@Z9Q[K(^>$e@Am2O} )' IF(`abfЙ1n 'ќ^}SQ $#'y'䑠/ƞĝԅrw)؅a dه.  gb84YN-_Ab8#ȶMU'=f5mH 4Y zmFCcEofYB2O"gz0jPЫ~V&пP̿P·-C (΀1#5L5[!k7&t?#چ BJK󻟝JiV\)jcU4w.&XĔ1K˜ZF$$}#߈CrH0*V&лʙb!‰{[>g E $C!Wu?L_yOe;y#!X<`uf6(UPzspy0 M!G=Blz.(Oei0w2$ /Wu!h |UN[_w[_lKۛ oЄ!<-4!Cs4 mUӘ6^5MeU96^ mU9"CZ!X-Nʢ28,gH0UQ 85J >4/C;˷ 񢵘STp<̏innCȝΨA1AВc29Cת8C~l|ikyou NC`oe(d?`ˈ1U:9O"xdkCVVٶHr@d_)_(G5< \2墪 NN%EUy'LQLQGLE\0.?ܜ 7KnBXe V$G(Wʳ9ɋZ 3li!$Ya͌ erEPQjˮZq!T*d͗,3TJ9``bЇGXV߸|>FaZ9 ~LGU(T%g:?HFRɚqn,AϸG+ٗk-"FHLy"FT=n妈L]nH?\Rb%kqq +2G7[{EZ{E]=L^ŅZ{EZKk7?m a?4ic??4i.'vovtS&CbG5nQatJE:&6wEz~FKy &6wܦ!K~UB'm3S=0򴴧C\< ]:M{1{hơ@\%e H釥T*D@=2M:GJh1h^SGs WβwIބ8e6p~ӝk q3"l@o^c&uY||xUjBxRǎ}8cPԕ葛 ]$?U]]+à͟vm)`vn\K)3[N!з"2'rI\KZm[L]iȩ#:/cפw+g8ǶWM\m3ɖ6o}méC` ^MLbW^r 66}1{#@\hOupǘ`6f/$[1,ǺBiF>~mEϽD%;LPͣ>ԉ"Ԏ{@Hy[ܝ0d=*aƖSbԏ^e<Ǝ2zR^gsL /X5ɘ,,"Ӻ] %[g6@ je8$MV!E57 $fݩ.jcl,9Ki:'d1[W|w8 aA8SLH(wbpc}LYrM݄=PՁQ }_I}c$X@iܐ]19 \>'e- 1D)`  5/ N+fl{ 2h {ڤiL]BwVf 1V"L $G%=vW8P!O%)o{ӔpHвŠB4 (ij3܇uwd)]ӑDZ]aWC9-[{K"l$~&ؚwo-%f;m>wXW{㑟7i&WhTލ`|X[vSF}e܆7ZF 7u UǚKz68s:R H5Wc)%`0g\?.\x|ҦIӳc9P, z؝pނ_Y'7xtiZً.IԾL`c,/KcSZ >'2 cCX<({A˧"Jf˚ptl Nv ݺp'%sA]F]ȻI:졆 z(t3ViI(xLW9H" av-U~ph9ޙj>ct]G)?ԏ/lلiS66 5ZXb[1yϲ8WϗXM wT۰c:uSPqMsjt5H[1)p>G I=08tZ5ZpL5ɄbWgEKeWPtKH L6p䏽$OI;j,۵ k?.{{^-Gor&aw%J9 HY;a6Xw0ѝ Ȭ(XGX`X;o ~9a!P!iH`!ic5hzPI_ɗ˿q eܼ܂?I yve݊Lq&.TTDPTP_{w~kuc,J OUJu'B*p %V~h|UCsw kR3=@e2AT _= +Ons狇_*e ) NT,n/oPX9c={s2lMe{kٖ`moLv36u2_'iD1/ٶ3;0M`LU~D?P^_b,\rrH*b; o9-,bL BCg.+fT,!5Ҵ E} hUOr_C; gXg̏A7a.6o䚏S˒6AY9&=4zNP3`-]uK#}W4F8 *)lz.d'p"_~|MЌd z9  \h)R  -aՒeeI^JwD̳9զ\6wvZ o A4*ǯY ʼnȋr ^I^hV{+Ѽ|#`sqMLũԝ:AT5h'&Z桚`$uw2_I_>Kԓ0J@OUAX9 $Gn"|BQ!jf貀W`sW#%.'9^+vAWIY(CΉRV%JU*-ksir1cBK$ eKG6TVeK*wDhpYN~6=G!=43qrN){v3a>7Nk.!N(Wd'zbbmЍ~dgʆU DnQ8#۵߾ Ďt5dZwJ|9^ DJjc>f|D 8F>t=otI1hY6#͗e/ uZq0}OhʖKRim@. ‚3J\DT )webIo"%-'Ǡ0nrr;ٻPW.@pO1NNr{l#_oyGKJ>kuҦ<^7(\(Dl& H56j̦8 4<WFb6$NbS ɳr=LRckyY<4}wӌX]-k-j؋QoK@}k#@xAC5!l'·-×a?2)3`d70lj^y"9Y (;dy3v-t"v^P*£?1.^w)+ߋ% `W" a:W|͜TA'̥oV uVO~2n)ym@ BP`r{ ^Oo{qL&~|m=!0].#v:3?&2r @ޜGx\_@su Ft BUp@_[h)PlMڢL[R#hIs8@rtCPQݮ/,ϯm N nÚ#%䥘H*d<\6}2fƬ( @M&ym5LԤ}=Y(j"-La툡7W'hp^!4&.;07Zs(_*n혝mxsFx|}2,c -e8nCnr&MBg\UA\`e@ҏQ#6Ֆ-m2=PmCvw몃ݬM:^n,U-sa-ow I6_5|TZ9oEՅnT}ߨ//0`]noTӇ[ӆ n%kP'mQJdK)_ B6䙗ĭDOG)V6ڕr? H)p v<y'Y?>!J}A@ =Ƅՙ ^E:`>xxyvIG3?=JVd,m:D16-ʜj hQ2 {y=irnIiE]B_SWŤY6m&Tc xvb%'XV Inob9 ]- -Ds<0Igy NF;K=vGrj{H&[,<W.BI hĸITqQĢpO]cjB).U?xCwC!]t1޾\d҃_k_]ֹDDjzv4)vZ"'4G80m;yܥft:9l -1@ <e}ڰB+cwZxDBn0$Q+D>(rZ>0>-JA(ZC`YlTT A䓸BϗP%/4Ft9F҉OHsv2 iq#$z-:g?毫IgK=ū-F-Yf[pj^BoDanU&Ҡ{>KiLq.o 5|bZ wŚf$NLZO *`0|3XF$C^kCZFkDu6j& ?̐{fd/l^dm-4(聚I2Lβ nZصPkF*u |5,d۟Nښ{W7^)bJ\"'(($INr"uͦZ*p/ֆO=J 瓵;8\ҥQ@P|<7!3M5Sԕ8;^Px7$l~wׂ3ɋm8 ܝ?>N k*,mD;jyjD嶚а^*{Na<869{Hg3z0AZT1|"vaQa,}ːS&w  '#*9$ FQF̂rtó ;~Fto3"6W?}klއS3S g= lIO_7k_t 9b78~prg?%f~>0x7IZB27O6 s6T}PW͘gX Gٕ܏FWLF ?r s_Eؐ(_%<dV5 AT_Xjf*;Zyo!¼XI2<YuAMPۺIރ&gcuZN^eЯ ".7uEtU/zSRu m\yn~MJKM_D_ORp'4pPI >e>^DPIpDE*Ț H?뼔|8qcR*j -3nl9"^z&]?I)3OWFQi3{NL}Zv<,>sq}vR\DPK֧4gIHHdş; {J2$V]M7L~盲2g!İO^bkZ r6ɰ0\[ٰU({zz%\DtD앿`%7d\Qձ*R :12ߑsrw?";WLg8ղXOt;|dW2"*;oIXźI~U jGvU.+PQPU ܚqTܜQ¶g3}6a {ڮWIw|PQ9kΗ! ZEUP]Bg''To;0W5DmEw6mu?1׊H@6\-!h$&f6*a+"tImR֕yUS='R]!˨bb$!%@B]}3\jw4Co4'it  3ZaMYM]"+PFz8deQFlީz#ےSr2To{koR"Lf[Xʇ{ܦ9=vaꆷiNo- ŭ?Fu(DFBtq_wLtn^Hb }SzF2)+Pa=mO;5w4s^si|3,DSžrIkhsڷXzwf0gIvg2 홻NH Ƀn4lڴϺi 嫫S;lȥ?)#ÀvpD苓9 }# -U~^32Fo݉]awQ2Tj1ݣK"9g{m'DŸ7sؾmނ)$)KI4lth\7O5늿W~SmYq Qo4?TM$=+wexGܗ-lʉ}QDT^QFxp?ͤqUԮ]gm#fL%яlU,,bsUa}=B/a9S:aM^%;Rk;ՔDĶ0Kte|ךpM+%6~S.mZ}Ņ"riHG3R#f5*CQ,7<']>5SWe$VpleuD51e4 \ыu6e\-8 Ed.,;K 9* -{菗҅IA8'k|9 5gjP%)IR`:`;TLMH?y ڵ9\ۆ9y(8kGqGWh;2`s69]fj*` =[70MfEnxM>`F[br^k*W1rX!XX?Zo-cݥ"W<|.q%xJkdU͛[l+ȫH.lܓ]IuRLɹd?/d9=Cye Rz #ʅ&re[e z@E$0v\X <\4XX] }P`;Y`A2>X[[(yܦ9t8iV]tS~`~ pfBb; _,Yj% q]zBB$g{O<gEC#[JأBm&"'4PbMe!c9Hh@V)ۓP:J*r1mecUʓfX8eu֔;O--MT\T$p.*OIaKK,sfBMdP7+]!7(g#`&\.Jsڻ-a]oQLE/d?Rt3

tӜcpHƘ:ѷΌ0/uD"a cҲD|t.TɣXV)kM~/bPNEa?<su@ڪӍ3:!3wi"kWYf{6âPdwFig?܎WUoid|綷R^]v/;w g\耠Fԝ7Kg R0 }هwHk";Ml‹#e TnHoB߄r:KsoOUX =̜G=lS_ۮv]_U5 (|?AR>V42QF֗}7ycKm`USۺkX "a:D}OYx/{9caqik<SY~A jF$ڕh˸o9%.v; Af< A>dv^<ᤂ V2ET; LfY ɦK>$ptH߃C0Bіc}zs.v_RLF~)|/MPUy̤(qȈi>e#W ߽0?yP6WaQ9r0 h`6[\Ll]sP+CIϽ?gA죀4%TTq|0{D>EٶHXliۏaܞ#:w1Z>`Hs2)͜}lSd*ho&3X)HGJ# ; PhF?V_ _v<3 ļkyO)dAr[Lm?˷+e2{pX C 4MrCL21{弰^F >u|Y?Ud @ 2vqfךϐ7=۰f@fbsym0ԥ  jXkR<*H\Y)DQl[+.$e!3T)&TvDa|üNe)'BP+=A9 w8{ 5eyv-t>j!jkaiaDnuI}YS{̼"BdIֻ XTHPv1>>Ҟ=]`9b/p5X$P #RLXhy-i8]&c|p)@ja9pϙ+-dm8o 'l g~Pdr6-ZX4 c(,)vb@LOK6ssqXp%MI_+Wƅ),]Ds:@LaF#nQEYR E$af]$ZNN1kՀ_9*"o3KIx,@M&+apP@X S8 $%`x>|I͡<ųHMIǷcl~X|O_w0חrpg }~_$D vcYSH#<"t_ڬdkɨ",:FI!$Az0sÖQhK$r@5c$;x%d5䙢 w+?V<6˄FZm -D̰k4{w ًV ꖸ9 ܲlkql7-iVsg3fB&SƒI C"/U"EpMwN^r~K>N's2r .bu?aB LD >lj{+CidNPpɆ9cl3 5#QxD'_cVܡS糇7Rj#¶(W#C r\ 1w_62RS`ؽF7,T7jdrmȓ aXE@I(;`Wlv[[鿛O'YG/}u3ӡxV!>D3N%3bϚf\DvP.q#0MiΕq I6 Td,uxn2CQgdi)51 ,Hx<&(бa7,ݔV7&ÐXMJ Gǒ"+użO?fح-dP, Ky6Ұ$*Mz6s[)78R2vƝ V|t> )>F)|V ?LU,Oֹ{7AߪoV,kfxVNCFC d8:buX :p.Mzc>ڑmxգ4pj(>aAC×ب!GUpM/kgg!rD?^j#ګQc`gڱ!*"]Ts q(󊖛?\A$"uʅ ]hkz?';-dzQDSǯ EP74 f&ʍDU㿽a/ Gs[}1n>i:ʮʇUs谆Pנ9,/giAwނ$yHR]Zo=pVSuu|T]ծ5S ɩ4Vvsu:`FD ÿxv•hn k\ZM~^]|'S=gw=;Tje+ZĈ"N yQ!1To.1OjCz-I}/`z`h`۷)Q*p-[$BtZ ۴Ё~xXxHv`ޫ  {x`gBmtBoMtR!C؞ (# )_6`Ai- >THa #\^{SǎR  ]A?rH n$"_ V *ZH@w֌A>A\†gO-MR(@t{FD(N0/7y1 [ŷ WS$2x"}b2lT bC8ĈjkĮ ;-[E nr7Yy]hH &{ rsu+oYcHLqe; ۞RvI[Z <ʅ}x[,X+Q-{o"gE>OGCsW-/ k$͐zxʓMg~[w wx5ؐ%)XeӡN*4ƩU)u+t,`6t6<ͦK7.4F:,ZqpHKVd(}#=`X'킣CrulgZ|4=;YKo/߲ۊ=y/},"/3W"yrH $T_/9nM!_HtwqI $^$E.[Er׶Z=L |\Xf1vثP@*Ƹ i!-?u/[A#[ir)0T.4[JjYr.,EMتt_.Wt_Yu%L?%:Tu+ 4GRLr6fj:J>V%S3O6܇ ln Vv]~>gq0"`QhuvvӞβ8?(t1ϟE πc~t P3-BW '#1? !=&lin#x?|Urxf.maeC~}o:ϣՏ[[z(*ooiR ثJ<6.#iP _f8y*2~؏8[*LDȻ.JJCp{1$8Jr{DsKiö}#{0, [6߈o#~I 008ߎ.o# ?i??Q?cu0_ˣx}@<b~`Яiጭ+@{^NzAV4Ǿ|U\BZa{ :?+&p%**J_'%NQDˡ"LF_?#kI~D%D/KLCb_KQb.!1/KL@?"kIsɳ6" Ϳ;NBLC44Zb$S(rYb耆_K̑t7g9F jb?%f0Y(igJ F|D[ցQ8aؿG#F.xbp$)<i2OI(ǣun>'$mhOXC?o7{. 7$Or0q [|~f6Q*cp"Irk+M\$aBGf2wcUoDqX%`L`7P1d{8β^cV RoL~$%kDԢBSbp׺H_'oh s?i"~w~.X&'+K }^I#~$=I|xr-h<&i}Qb?Bt95 HjMG4z/=r{'Bp_5,/Y,R| h2]?lEmT!_`As> I,]]3z)?qX{;{0v f͸݌͸یl\q7^b,XJ dj'=[iL@<BrV6lCygtkzĦc1\jӰAE&Dтmnȓ5<ݗ yN[0ꐸ1^5FŇk?WnZb11H@bg3<1V)R4Kh-O[hM, ? d:&&n* ǽ>>ܨ5S)&#V6c9e޻`cL+HDxh;Ck4[U,W`oi]giJR/'66.8X |+B6"_Y+Yj7*YBZeg;a}Cc=&] `ԳGOcZR%\<ܬI\?#87d3Aw#;z; 8f7ۈ4St)KSZcFi'< -򐄝#*y?GFb.@)D'&tX-_y0_Iu![N`VY6LSwxe\S])m7|P "HmAدpY@B5jnγɟⱀūm`śֺ0JlX,6XlעH%9W{֔!a4!a at aV0 lc:gu2)@fάT`Llٙٲ3 eg]$SAڲ @4ܰ}"H3]Veq[@5d;RoZf, `Z9Hk]bMU K,hi^k՗y?S~]W1qdĺ le>K mWL]w 3䢧$,s-YΒk=%a=%$3 ~Oc|mVT7fHd YQUw v^1^`IOWzD}/1ASW<=⾜DlYn_+>q4rfo\բ{=w#z =W$ҊB;6VpDE+(VP$ZAI0 #zOBQq#GBQ!psT(sT(o⨐b⨐vT@;*D"Ў hG5kōRЎ hGG8G& )& )hGBQ!vT@9*7rTHA;*D"ЎjhPPQ!Q!vT@;*D"Ў (GF )hGBQ q MRLRЎ hGBQ!rT n䨐vT@;*D٧E{~_>֕ԗUԬ?*]Sƞg2%jm*W>Y>U.w!=Sk*6J$ofUI0뜷Eߪ$mAWeP p[O4mѺ"-FWaE x\\8"8J/zӲx̱B8*1*MO==>b((3UC7êQ!Hcj2V5DF!j'`U Qƪ(3Uá jH8 k1檆(cUCjH#U!Xej%U XUCVՐ`j1W5DT-WQjFi"UqrE+RE0[ %\l4=jPbգ֣T˖TmzVոlIj\Ԫj\Ԫj\W5.[jR5.[jRypT˖ZU˖ZU˖eKMeKMeKM8 k1eKeKzU㲥&U㲥&U㲥&U%qRqRqْ^ոlIոlIոlIոlIj\Ԫj\Ԫj\tE| I:wIuJkӄ/s6W-ק++y`P^xoM'SX:;8if<>?*oUk^hKmiW m1q^(&plSrlgg:fKHV ϖ:g#mS-S53U8ҫd<8U5Rxtsˋn4J-?)S,TKP{8"eg-6sEh5X̏dp˰mR='xN/2Bެa{X\UU_{rN"4BX[PZ.Lv]-d>E i-pWe]Uz 2\E¢_U*뽑 ϟ !l4+td,s1pV>3-`^gd[YGo4/J=Iz\> 6 _Jvbĵ9ՔCǻy-qk(?NI7LN+HeR%e`nnZrPo]t,'ڮf}_&[V)!msv;8kǜKߞ|{a,&+y!!дE">=grYQ4 4|bz讘-guWjެBQ[X'5=M;jz8͟Sm鰎NヮNuu29wTv2dv'$K˅.nZo?cاpO)̽ܲ[չew?arȫuFsKZ;!1‚>|{t=;P7VP L _A !~;}Nt?kgeNԅ lL5rB Jm,u|K$PZ1.d?G #{/jom~kr㜹aqpu\TS*/_I.wd#|aH#G/j&Qg -]Z)?Lg(.`gd~ڰ#!KiK)'*b1BN[ CKe=Ӹ<+59uggFաjzJnWȏl%<-#/^S5&uŅɅn& *2`4ݩul5wݛ2Lw (6/ceBd\i3:]Q>P0`jjcXd uj5yjtPK!jn word/webSettings.xmlώ0ChVj'X=vBO߁c,.xa s?A.f~~|:s*AX|t_*ŝ'mg¹r\Q;k\Q?*+!;!˜P`?*] Hm Q3z QST &o@J0n͜*jP(I)y$ e|ߍ*w[E'Jt>נRG j6w+*>#f_7 ]I$5K}[8UiDI7+֎J5?8 ڝ)6P&X27uS}2~H[GlUMzUQ7iwE\>tf4 A3p2;L;`Gx}vdh ǃcJp8q%qm~AtBfi4oRB PK! k word/fontTable.xml]o0@'?D~/qB(*T++Ҥi]=!b; k'PP`"ij"sm'ViÕQ$U))X"SR(ɦh wWM2% 4A(9T$TfJ bVBAuyC(K^p ck(*8e] &jVQIi5JԊ2c`΢ypyDI $8ʨ`2͈< GؗDt-m7Ƹan# `R(kKrbc"6ΑO+4Y@ <ЬIH"םXK"aTmH1Exg!\xBאDuøgDbj%+Jnionu+X%Ns:AFViz4gg. *x#?gĽ!~1F#9~\,^!2ZFneF5z#s֜i䂍V R׻H;|n6c.dJ)dm(sR/w&8NKTܘn q2zM*}8 o$Lo%oqi fPK!xW)|docProps/core.xml (|_K0C{2JWAO ŷmɝu޴:+"ޜ=ܞu >(k$0V*Ym:'I@n$C WY)\!oxTdB!܂l]Ai[v =mk4yҁC>N^\U٠:6^g>ғ.X vxlm:ت=$9|&RAE&(oS .>`VH_>p ^jb%r>p ;N+ j_&w@܃ʫ*qu>VY]%C[F9dC@zlC(k`y˲. {{ |nZ avV= V ;n|рP4fx,l JNo(4q'c@Sf}:МkN4rL9Fa/PK!t?9z(customXml/_rels/item1.xml.rels (ϱ0 hoPK)t;JGILcXji߾+t(QE]1hjP >N~j.G{J D60o,W0H9X)ctl'_uݓ|P=;6w#w Ev d*yB1ߪ kPK!.lword/_rels/numbering.xml.rels0 a۴=,"Wq`Hi$eA'3/~gJV5-bcZ\)8|~`L:11d*CwK޹s2礨u$W6of; C]s".n[ny<5ܱVWs[ 0'hD5Ugw&&7E8TMYƿߤš҆!wak{0_WOTo)!IJlim *xD;뇆dhj$D>:dkm9=u\rlr\`udLO1蟳;O.v06%'ţ'`R-2hlAbn4=• '3[YW%NqW4-FSYhy b{|J"Jq(E˨$Q*C2J'$@1 lUJ{xdfId_fJ=NuN$TWV+9yy8wtzz/lcFJ*~`_`]F#9@v$kv/G=4ͦJ򖋔WvxT'HH \uZ L𯳶vB]EZB^uΗ2=l? ׅj|O;hC~-[ @@}b;íxo%&RG?`>SBSNpA׫Iiө.`d}ۻg*'|%>P C0ifw*jM*SROh=b-倩6u=VF/@yHU쬿݂cWԬv2 QOy 9$y2Kٯ[9_0嶘yׂ: >gkGf&A9.PM8m.V"zk'툈A3t62  @#X.r& ]EW^yéR|Zb| F6~nlAP #AlMD1vKF^eT|ߩvsUoOڋr33D[Tat(LC.`*ajkx}Ӽw-amׅyuBLcv8HU?"Ci i򕿄kXlbQ;6HI:n[8$)\r \T:^t3B*vp,_ݐՉ 0ܡgiP>07SP;؏&HG F~xzDVR"//6C<…\Ĉ~hjs:pSJ5`99 6e0kKhSvm$qm$r~w@} >%r爾LS:kXg܉7sDZQ; }~~d> )#z{2DvuV, ʊU A׽ɵt)Nb2-+!!~ "bzxYKzM(#逻/oXOgą? ɗ[ ޢ{E&9B*K&8 A|Jx]Bd&Ů%wihsXbsq(ܿmzR8aaFNW<+n{6_Y=(+ "Cxœ'%dKZOKbl?^~JbēWCU G:Ltq<ጀ0ޥjVڰ Bѳ.M. *e`f"`w),xmPnQ!1^д%GE?|F[*r=,n-`{-v NKՎF C⃂1D\DW}X?S*e@3KЕn+ہGFirrIyl+'>w>+ -{%d"IOs}eqG*`!ZW> lT9X0SH ͼ*pMkn'.%2fFdbPq6zŸp>2ǔ\ɁTpfzGHD݅omL"_~#ndžwy1'G™y NzmP=.x4E"rnAOhMc$6ؠ3H=W*:ev]ٝXƙ2c"1fO4CUAI {ODd-US&D&9Q{lZjL@=7S1Au5Ԍld0Ҝinh eey7[ZPV_ͥh=Z\֚WJ'*=,]RfzH ~C^l]Ksba+^UҝMUZ\<~1/DYPH4hBslTd%0ZUV`!)!)c%/I͔e^twæŲ}AK=# Mf X%99Dem<-w(jh{P=aE9!p\PwH'?fC!B^d:jGZN\;'tVH9 FQWl{Ax򸩑:7-;J()?ZU4DyZI1\H'2|'Hk; `G N>SpDeܡFR(Tġoz=OcFk" ӌ*zb[yvO#\Hll5CSFEԌ|90 j$DPd a+E4 y^p⃭uyUx^R7$p[0dEg XƌOALHŗ2W6.H9">`M!xTgO sQ1wTU˟M=++[S̰cRt_w/Lr?YCp$+Pv mXlЧɽ(fM!worui0z&!{G QEC(̣WIVm4o5Do{^ܘ_ />kjY8o_;9MvL ]zzl:Dg 9lS%Sl$4Af|Nhf0$pIbPvv!m˶2Z~ƕE K>{'BiGT$A1aiAOg+$XⰣY2C.؆zr^gYMۻ~~F.ӮY\1oW3E{}ŞdSFA#Yղ Ԗ"pzr_q##= +~Չ0cd& X$\/N31JS-`-`F BuA3˦,AIƯՄ:b d!O{bzL _RXxR8[>|Jx_tYf=0֔s 51L}a\/ -Yrk@?[C.#G5Kܴ~҉lBUꤷ1J~,.Sņ34>Nʝqƈ.;o9NOOsɹݛm?2sAkWժ?sQ"|UBZ 8j4&jusY\L00x #cn=BYM/Ƥ6?Ccu8_Yv_Wq:#֫ bTo 奄CXqkowShNG(>}ܔ`;t[ 쾪6vCERPc!!i/TX %ó._7{cM1%#y8x;0w;Oo\#;^MU=J֑PK1Xʄ!7Kword/document.xmlrȺψkF=Fdo<;HJr䈺Y) &0P@;zb'lDRKn)1g;D_fRUZzd"d>*4;= UI/$h>y-KՓ_\BN4EU׏Fqq~㫢Lۦe6?b$J{8_/7~z~A".kkX_"qxx! mK9_RcnU/ՍWnp׽}󕂯{%+_J7f/f2Ww4կ4.'ّzY\4Kke4|;RZI"^/2|?Y<2?Ϊz>|kKȫtӯ}5uE.?\N_֑r-/ /4[ϿehX?>oa\jW}5_} 7^?5k<]n:ie_'M6^ TI\|ѫث~n\quޔ~lmiYgׯ~۫=W}@gշLEɳq^0SHuZhX41XZ:Bǘ_FU"K]_oĕQ寙?_/2?es UܼV&kBe:ǻ٢]`IiY 5]9(4߸uCFYa<-D8VXs+0ٺ 薛]7o6տR>5\Nީf{euR:Y\NNۋAEo [oێ58e-?f\k`V-\a{y/_r,WVJ5/],竻E]տ|G z;dZx,yV|[}5EO-E^Wq5JU\i^jQէwnT۷=^+P5y={7tRIJ^[?O.d#J.h ?4gx:aiR_<.F}dyALXtY_+x,IH7S>K,'uZWl^|[xw /Y64O&&ѩyhyN+U0Ui|w8\9GEV^n4薦6r*_8;d93Ҹ~`Fv '~[Ѻ# I]oV[ gN捆t[݆ԋƓZ'_ь҈ ?N"Zp;l}XF`~x{پF`_f|9+~]uDsN^/{<78Vy ln\SHw[{fs#;MĴvn훾wU^y'r=qKOS;ϗ _nܴUxc=7;h^Kn=g<Խw7D'n.'yȋeQ[z~=х }IZտ5s.:U:emQ5]\UA'=mCyq1j&bld\~67YV\e3դb垘;d.zgKټ_>U/}~e1/fcޜW.^bv^Pq.v_qϽYpՅtb[2_H}WDQ}x˫ǡsxx]r[RqPskoQ=/O|z::-t7ny`rbp^5Sd?뿺Rz:m^_R7^MږoKͯ_?E}ˣezVY<#o`qpn~7equ!Z}ۯƻf42/EDNr1LOrNKR֣ zw<~Y[^*!y]4r.wzs{]sgeU?Tĥ:˗o VK5['gE]Ī&֮sס6}U):}՗?yann&inCB>oezn)7. Dt3 B7ݭ&vw&p̃m2O*0 NwÍs?6wͭw09qϦs{/A\ޱlcԻ/~~n; |$_g[=ʁw;7n|ݸ3_|)OXasc:{(S Q+Yd{2߶t%ݝwݫ%2g{~X78;OKl{[Y?a/M &/TBQwg%,*ɱB*/Ҫ.ʿ\¿Cߋ.^v7}K ׯT-z[WL[}l~5GA}׳RV/8{TXZ=/ 54U)2ô4W߂CPob<ŅEU8D.k'Ǔ^Vd4m˶E_;a+w\Z7}q)i<Lr!sշR'dhi)X)DLxq%BebVdiʉtXWcj>SƊkIXULCǥT=Bfu7}x6}C[Ni(U\ RNe@]|xF'E1hzmӺ3€&EscYiZKZ&8W"8:'rH"Օ7@iGW8/8 8.󙞰ei]mVoM'kZf]7V!o+Sיj?Tnad۴.Lt|ݲN<{^U2[i~j'(x6+:˦qohj[+Oo5)lu~651m -}v(UWlnE@7g1sͿŬƙHI]p=(3Lzz#he"d)V(*.ȓx\}L `Rݬ0?5w|KX .х.MFYJg_v=6OE4?W5i!IħTNj949Z.tt}bȿz)Dc3C?/DH>v \ j6ϛ[yUė8=LwMݮOeǮcgZk:C*TGr 9'Uɡj9Q3pȔ;:^lEQsMeU3IzXdYzfqJD"wG9'^xMTp:+lsUGG"^W_UIٺ}?Z z(h EVWK7Kk%Ņ\Mjŕ.٨5/dW G㸬q\ ,cnGݨ[ݨjYA,i7-VHݔ;ݾ&ݡ[a9O/N&g"PݖŊϛB߾cj8Z/Ǣn\6eD^^6da,Uĵ1PCr>L+OHj=|RMl& vyoKKYLt>~&ZRN͟rh~ʺΦsWw#Yx*%[9T%zcRNV78QDDu@ij2n."oڥJ냪jqiCK6ՠ]1$6NqMBpq\eE>cB޷Y=\e7B V߭lEPv^纠zP:띞zCԯ% 8t}ofwE7Y}QkxI%k,&~FETHܻO >nuzfNU4d1.e_nG[Fu +ՉH qK5刺Qmﺩ[MZ&!vw==tS76ںwDG\jօ!-ױ.޳˭-ˤ+t+S8&膛˅Vy D8\'.h]pm^{gM48OeUsygu0y\bXj(ZiJ+],ua!](X ht/€l}YT~RL+]aZ4t[\ Jy)yc F?G͍83Wimtx_EY_ 9} | M"DWx;gG咺ޙ+rXrUؽ&@'yǯ3xN# qr){\YW].ӌ #1o x h:82hϛd^ZbV)GY:OHN*A_\rhiݠSM ;w;ɲ]˅ ζPL zl`u*WRXQWW֛ve3ZdtXW6zlڷ+rmɑYŶ],!eq,Ee6-2^u@n|N'fҽwf,cXƱn"nYs]{x۷x]4bO u|4}O & P*?-.ua(ZM;&b'.uH"XJhs( X,rI=Ƶ(-Oխ ώ׈%*OXy=ù}w;\/WӜt[x ֪]$`Vƚ_Ϛ/MQe)4i-.E)]њ2)DwJp\[\ęzwc(gjqwcѪGN~wDߊ xݰ>Zםw_z{׏dzp^"Uc"Lo,bUb[?>{(fEE'?{5\rugaa}':KRÝuĺ"M^_*9(+.iu)$zΪ[ԍFqB1YB7izJ_ʬD|κsu8P4+v>qt1*NUCkfw]{ʉpұ^xvn&m[m3,ϫz/3}Z{Z{?'>}dgY&ǚtYV»;>g}.ەnn7; b6C=TCx!k1q\E><ޱGt7t|-cdM]3y2'͞aqI7՟z|^2ZH0k!t tW?kg>?K7D)<z/#|˽~ؔ=\˥ʁ+]w뮡tq1*Fig")2#)Xo IXu|^3rW⥬u^ӮzSDtX v|7s^Y(y۝`=ӍNϨY٧͵+`zնy*UWkxVPi{<߾ } }ӢGhY7Le.]Ve9NFdɍBЍI˾^tnҀi1n聓Ֆ2|FGj%pGU!u6HD.nlEquQ4n5E;B|l ,59ַ"\t.uw|2w7|7އBSu i;z_`235Mj*s5Yݻ8l}w?O'ھs1Xifsxs=섷|1r筷go':CB;ׂ=G Q)>-3]Q'Pˢ^f߭>wVzjRWY&uthz##z_\=OGzxfVr7zFY%h'j.^Ͷ8@ߺ;?W^`ɋYTtyw~ l+~L}ikD|8{*Qɭ[|[7x2ث# {=ISu]ɺ+zyQNS}iT kXV@s}M0 \ѭv{^5 Aek,+1vt}}'{U62^ݚ ō9WvڬcDz^k,Y;׳\ r+2MOs2yY̚ij|y!M-Тtx]O,{Y^5-AwʎCV7vw}Zn&~_z *Qg5o׳T,._1CNK܋x|<-y jtߘ͊q9-J}*D3`[qѺ/0ԉ a7 .{,KW󤟚͎|E@|ȋrz?yU+a-xk*yf:5w _|t'f3Y8e#U8}F݆z;Z}Zk^=uӝj;QSQ+2Vʺ:/ww}ድsصn"]{@cVcf)=.ptƮ6:[뉮 L klrأ|M*UJfҏͥjgջ=\$VY"ύ=աEb=9+9d4x2Q7m zW^c&հ_-fKvݳK'ڽvM_lcKSFZs}%7iJ沮,Jo 3Xf7MoVoԏa|q17'ѓ] o,5r3a^e7#uE: b,.|ڽqdfc)~EkE<ζyGp= :>;x]y27R /_tZKM@$r]c?-nFkwqp=Bݥ+\OY~;҉g*pkqZT }"ee#l'\.oߵ.G8/㹮>>rj_Ix)Y1rnҼ<]6{'P.ck131T:e:s,iOtPU˹2EM2KS}Pg=4y0hNu'Q糏5_{LAy5(z1fjo5J4+*_$|T[n2;ئX:c:?E6m_ֹv&畼6ӳ8.J'5jJuI]]Y6 H'FS]zh%r-O:8+I5T_`̺iz}\WM[-fsnG"b֭sJׯq;˛-΍+U^mG >z'۷"zk}m=M,?jmSAY}kzMÞg]B\{{̥ųy&q\]'<)wto=trlu#t}*ݹ|ݢP;V9z1ǗQxu{&W=.=I {z4V蹩f * O.=nN`ԍ.ܝfYPW7kIUwjX@ &Ŵř&Erޝe>a9 h}`=붌"~GuB7JKb¶w>bSq4ᯗd8tgt>v˫yt12/Egзn5{;rXr4 ߴZO:A:Agb_UOgR, I5RzS}~dմ2\eSWT;7 %_їЗ://U/!u/iq֋M`}Q$^!Rx+D2yޓ!rL;ߢ.[S;0.BX CeWc&_/ mN4/ռZ$^zS7u Ŏ>Z/ltt~kgoyTze^hܵ1!DۚZ3D W[u 1K}){5޸L iQ$Y:n݊nБn)WݹL_LjcB˿{fȿl*6>3^vonaKqOz`P^Mց_i!=uz,ѨШ;?_^M^PIf:'UcX~hn aQnQhL`pA Oe$yZ|,LMMVb*cNO@V뷿?/b}9V-f3Y&BZ"K?((vOډ!L۽ۗWE.Ky~+LXcxLrR3Q,ݲh]/. u{Y-e&!`PQ7]h i< )'Pr/ե.z,vm`YT~X \ ^E-.ى/<-ںk7鳸/&w/4̊E]7Poͷ<؅fow7E_~rr륫8+|~݅YN;F0:78~x".t"3ȭ'DXH=LؾhUaYIG8zX~~;JMNtΏ[.u{Ȥ:2Le}YrSLbxQ7awu/RNl1cUiwaǼ7mg/O_9әzE~"r]]'uYkOOu,y~+5eE1բb&E)U7Y4ղ?,ӱm eB]C+:ͻ ]C{5ѕ̖fVG6TA(gr3|w6`}ܕv"z9nc:w[mLg<4[?O~;.q,։}, < ӓ=a럘~78nLs̏~K;v\'8O= {۾7dYk.T[aLuSwߛzLrY:%:x*jՁ(orh9̡i}Y4 Gʇi!GY߳Lz<]bq&rYk~HWZӲ^'y>D;'Nӯ{}tkF {퇿hM= y,I_~-%"Q7=j~z:w׿VtɷE<:__e:P,?@"͓bMd<'*| f',+QųEGvxMA2I=?ߗyѿVcٓYQuZ修iYLui1oUBY[KۼiU^l5ube-4?g3Toy-FSy#aZ~y~.G⁋^'Ri-~KRΩ^sަz^Ja/0z}TttZv?oRJo^*KӸzTd[la~-Ǐn=Vc!4Ns LO_x㸎żLfoLlOj:3_W^rwy|YYOe1i^;|Y-!ojTwk~6_4Ej":~n|Ӂ}NTNzr< o`u} NlGN}j&0K 9 ^tL3>?2c{/9f 8 >-%G?{{4s:?H&K'l4q Zkk#g, N;A/p\߾Gp 7)aD>#1sd2sdvv ͧ %aΖ}jc3Za` ~qq&[ J337JoAo1\urQzZ=QX_s\\$r9qjw̜GS9X:GqYZ";f߾e8_ۋwqsz SuRZkg]{ܿ~ {fo~~@ ]#i>rO ~9^IZx+Ls&Rcwi t}>·N5H8'_>e{?R\ϧ_9 r?K<ϋ:'R``A}˴wNffwp7Q5c>[1CVJ3YѵaݧsWXKJL2A/\sktNwNZ5Qz?m VdxA8kOp^ջFkus]>\vX'972<6O;c8 P<э{g]In`դ*c.KňX5;5$^Þ^L?x5^GyZkVr^vgdztu,Ʒ1MGeQQ1}FHmXq\Ꮫ7"7\(#9v~98O}U'꿾 oJm};||%>^|ߔ̻-H|m yO|';qz2?I}&nް}*/zw/8l=m5^6:vǷpIqr-պB\~2fE]iU i9gqZJ1D)1[ŷ^6Dž7{Vdj)'Ra]5)2Վx!\p.8.8.8.8.8.8.8.8.8.8.8.8.8.8.8.8.8.8d..8.8.8.8A)\p\p\Cr:WppppppAppppppppp_47H      '   6 _<\Xn"8.e~fLכl \osUn.,qC!\o\o\o\o\o\o\o\o\o\o\o\o\o*\o\oHO\o\o[\o\o\o\o77777S$޸޸sӒTnnnn=rӇF|n9g $ F}nn6"^Kn۾!RʩjPH\R5N| 8MƘF&ppppp3E } w[ ĽO|n4L$w >;Xlm Gr2R%Y˪uȠ,kIqO<8MƙF&AqCqCqCqCq3E }`Z ƽO;:L0n0n0n0n0n0n0n0n0n0v 7wōō>;46YܽQJLʙxW90I27ԍRۧj|Qu[Gsgru&XCXэээMээээээээээээ}FM&atctctctctctctctctctctctctPatctctctctbtctctct01111">8.WcU4v7v7v7v7v7v7v7v7v7vwkZoݍݍݍݍݍMݍݍu;nm}ݹ}AWhlשU\i">z#z瓢m?ءnnnnr3nnnnnnnnnnnnnnnZ7A  ֍֍֍֍ Z7Z7Zh*>7>7>7>7>>}nu&8q-o=/DzTL8O qVdzd>y'RHeu%b5\Cv֍֍֍M֍֍֍֍֍֍֍֍֍֍֍֍}ZMB&uuuuuuuuuuuuuCQuuuuu٢uuuuкѺѺѺѺ"AFF>8.WgttdhjN`v7v7v7v7v7v79v7v7vwv" ec5d8.Ygⷣjug.~\?xXXXXdfXXXXXXXXXXXXXluV7q ՍՍՍՍՍՍՍՍՍՍՍՍ DՍՍՍՍ cՍՍՍMfЬ<{6767676767676767676wZg͍͍͍͍͍M͍͍u;nm~wqF!o+R&WXP>T&z9X@dg܇s!|n>7>7>7>7>7>7>7>7>7>7>7>7>7>7>7>7>7>7t->7>7>7>7A)|n|n|CUnnnn}Hm4MFwээB;ZdtϞWyb߮L˪JEYQX6эээMvээээээээээ Zэѭn8M膯&atctctctct3Eээ}hFXэээээ ээээээээ@KZ: M q{1n~x/UbY\-H)ݲco(/%d*$oC²I;]X֓ 2nb7A  ؍؍؍؍ b7b7b?z*|7|7|7|7|7|7|7|7|7|7|7|7|7|7|7/75BS&6mwww݆!xTRd(ʉ;E-TI]>gڋ3jƮ@@@@ݤe@@@@@@@@@@@@@݇sMkBnP7A    P7P7PAum*(7(7(7(7(>-?Ȍ@AAAAA@AAA*<0-*ʍʍFoZ&L.j5lrFݜ/G'*U7&_z!ӬٺOyRO]2߬BsY!!z7z7z7z7z7z7z7z7z7z7z7z7z7z7z7z7z7z7z7q ލލލލލލލލލލލލ Mލލލލ lލލލMCFFFFf=aEFFFFc#3DFFFFF@FFFnv=aE000000$000]goo62n{o*S楲YO\c몈Ez^zjUmi9gqZԐT"K+u*u~r-rZzRL>rRIUoQnpCX!,p,p,p,p,p,p,p,p,p,p,p,p,p+,p,p,p,p,p\,p,p,p,p88888S$XXXc?܅pppppp pppֵ       '   : [|o5DO W 5>>M6pXSl@HHHH$gHHHHHHHHHHHЇHHZCH!ooooooooooooo+ooooo\oooo77777S$HHH߇&}~ 俤U]=nn ݞ8Kgfqq275BRAQz}0tntntntn3tntntntntntntntntntntntntntntn:7Az  ΍΍΍΍ :7:7:yu*272727272>ˣdndndndndndndndndndֵBFFFFF&@FF>GFFnF-_Kq!tC$XEFFFFcw#3@FFFFF@FFFn@ފ ǂ& :@xCxCxHx;!X&PTrh.r$:g*RJz{uG9'COoTݴQ%xM tM&zzzzzzzzzzzzzVzzzzzCzzzzpqqqq">l.c f E2$b$ 2i / G//crěj&>d&v@AAAAAAAAAAAA@AAAAlAAAA rݠݠݠݠLvvvooooo1[>666666666vZENMu{nޮ(ᢘ\5^mMUz~~~~d ~~~~~~~~~~~~~m~8M߆߆߆߆߆߆߆߆߆߆߆߆Ɩ߆߆߆߆F߆߆߆&ooooo3E }p7HEFFFFާm#p#p#p#p#p#p> p#p#p#pU]}nn vtVB=[\ i^-s5L՟*">$sRl  n8M>ApCpCpCpCpCpCpCpCpCpCpBpCpCpCp !!!!!!!!! :Sa^kTW0#ᅞyK۷"dndndndnd#sGG̍̍̍̍̍̍̍̍̍ݮV$]hTOQ=EaTOTOQ=EԃJ2STOQ=ESTOQ=ESTOQ=ESTOQ=)+2\)z)HzꩮWOTOQ=ESTO&zAUO9TOq%)z)z)z)cOSTOQ=ES$TOQ=ET׫"z)֓TOQ=Eԃrzz)z(z)z 'TOQ=ES-|#z)z$)xbB)z)'SΩ;MqDŅ:.uF)ӵwy [eTSUHNGn̯_L .e.bREZWI|JeeyTB#5m\<ɓ&X=9q~X[M2`;~ۍV$HݳMK8wF^K8 =?;'po4/Lh̳Lv۽$`@.{~skyxon?tSRn`̶XWf/ 奾zcJ_F9+oޮ_&=sߗ=\eOMՑM䳯y_0{rkn\\iTgw2oowů8Oֿ-~ú<-D8VX^Nh;/zW.3V[ǽ,s#g|J~ǻWDkNr%E׎T8pcy~(thZu·{1mZGٔ zFwo]"lG۳gZġ6?0 ^tL >~ ({5Nσo븞W?DwqL\ȫ!^IY^WE,+$R/OVUj8h$VCV? ኩY*T3oooo8oooooooooooo:ו²67q d Mf}.fY L+e8777777)77wjc;wq4kV4 RL_ZI Sd2ʥ*X^_Ax/vK[&WENJ~ċC!pppppppppppppx+pppppp\pppp88888S$'?u`````{D8D8D8D8D8D8D8D8D8DxJ:a$]'#pp6~Kfg_tc5//8U)-'8+\XQd2t!.գ.zLU&Y2Ǚ!K(    '               '@AAAAAAAAAAAA@AAAAsAAAA r LP׸„ÄÄÄÄ `aaaaa!$`aaa[*"pppppprpp+၉F%jR^\LeS*y4"b2MTΓx+)tĸ^];1cn.Yɪ!;'_UOB8B8B8B8B8B8B8B8B8B8B8B8B8B8B8B8B8B8B8q! NCGGGGg!!!0|'3@GGGGG@GGGo]Bxpxpxpxpxpxpxpxpx<8<8pppppppppppEpppl8A6666666666666 66666Q6666  l8l8la-Y ''''''C'''''''''@KZg&&&&&&N&&&uM777777:777wZgx M mۃn~hA1Mm0ěYYș\UbXL9OtX~R7oj'BfP&~S,`cccaccccccccccccD!o777777777777777777,.7777A)ooVppppppppp}XGޮVaa<8<8<8<8<8<8I<8<8ZBE4JwֺSUYajtǎ !!!I !!!!!!!!!!!!vV7q  g Mff{ގLƻ]1_&6xxx6!8ihUAB#艿[џj7T&٪Lr"2t,/UԠz:lµoooo:oooooooooooo8MƱF&A}C}C}C}C}3E }pY S. 8 8 8 8 8 8p 8 8 8 xv1mÏ HpHpHpHpHpHpHpHpHn!$8$8$x I0l fU2-;MD^_rUeU([޺P‡'?d<'A !!!!!!!!!!!! !!!!q!!!! rL@CCߐߐߐߐ$}ooooooooo 3I ~G߀߀m6g2TiRr[uXֲ.пrXU!,@)loooo7oooooooooooCooM}P!o777777777777777777 .7777A)oo䛁 װ#ooooooRoo#ߑ Fo񍚈O&2_@8wmtqqqqpqqqqqqqqqq qq8&7qǛ R qMfL ]nnnnnnRnnST7T7Tw jݟx57[ ,,dwbEVKحPFNJ !!! !!!!!!!!!!!!#o7A ›   77?w*7777>it!*\1oP?*2SB'TO1zĜ~ԻrܿcsLoLoLoLo6LoLoLoLoLoLoLoLoLoLoLoLoL3Lo7A ӛ  77?e*7777>)otA!*7L ʛ$ʻ딷 Fix\;'Hj xx(UYNJY~K6Wm{ do8MưF&|||||3E }pWBCCCC!!!!!!# !!![*3$ Fn rXO aGeo^"WQuCU`M̛ 1ơ8MFƹ&ȁyyyyy3E }H^ ˽huv]Ì`aaaaaI`aar{ܰܰmdFe2V8K+)U(Bft[=PYL]nFlXnY&l7l7l7l7il7l7l7l7l7l7l7l7l7l7l7!l7lfMnl7A    l7l7l?|*777777 777777777/ieMuGFFnD-Q!_f*y,VcC"C83?d$Z?8ݸݸݸ$fݸݸݸݸݸݸݸݸݸݸݸݸݸݸ!nn7n7n7n7n7n7n7n7n7n7n7n7n7(n7n7n7n7n7-n7n7n7n7A)nnqThnhnhnhnh=GCsCsCsCsCsCs?@sCsCsCsUc8474747474747I47474wi4w&LY:V)KZ&zp'x鹬j?tZ>l!eF z8E2O0DJ?/Sl.*kYZ7777i777777777777VM&Zc䀿">8Ek_aaaaaxҰ#Ӂo@sVVVVVV$VVVx+++BV7[ŠSCX/:*Y|RL+ôr>NdݔI5&<[(\s೓?(cuEź"=[PضNz~P]X|8q>  Ng>>>&&&&&|E֑iÄÄÄÄÄÄCHÄÄÄU8iL8L8L8L8L8L8IL8L8Lxי&&&Lrf7ӱTJRWxhكJ)as]}f ӶH-XEFFFFcoooooo<ooo-} <#I;/x-uwpd!NRʩn2_ܦzWs=ȑ>Q""XEX;;yyyyyyyyyyyyyyyyyw5?< o7A ț   77aB?~*7777> #nWp 3мѼѼѼѼѼIмѼѼ;yGhhhmԼVjޡ!X&PT6;=QkY˸)pIố+9!nnnn"|7|7|7|7|7|7|7|7|7|7|7|7|7|7|7|7-|7|7|7|7A?Gx,{*~7~7~7~7~7~7~7~7~7~7~7~7~7~7~7/ie)^ x#x#x#x#x#x x#x#xw[^A#x#x#xKm%w<e"d). "82S9*".j1lCYen !g"E<֕ tctSORxkV².7777y777777777777szG#CʼjI}l^FLdvrнѽѽѽнѽѽѽѽѽѽѽѽѽѽѽѽK,k{O<ݛ8MBFFFFFFFFFFFFBFFFFEFFF&ȡ{{{{{3E}p_ ѽOYHCtCtCtCtCtCt#@@tCtCtCtUxF7F7F7F7F7F79F7F7FwǍn}Fw-2މgϫJ <1ĻJGŬ,Sץ:{S}}4̓X?DGi;o9ˆ݋odm]?ydKzrsv7q ݍݍݍݍݍݍݍݍݍݍݍݍ Lݍݍݍݍ kݍݍݍMfv[O;\Nczczczczczcz#C`zczczczUWސސސސސޤސސ']HoHoH6NKHR~j+<2=8ŕR7-u&7m|ZlA~*0IC!nnnnnnnnnnnnnp*nnnnnh[nnnn~7~7~7~7~7S$wu`````{&X7X7X7X7X7X7 X7X7X7XwZ:pppppp$ppp=nnrݫdszA1UWkqY葺76D/Le%e1ա)e!g8Ԑ27ěT:LΛVUa콩0C;@FFF&CFFFFFFFFFFFF>cnZך1ѼCh!4o4o4o4o4o4o4o4o4o4o4o4o4o*4o4o4o4o4o[4o4o4o4o77777S$hhhyo+7777ÿ!777777J777wo86777777I77wo컅ط 񡡦vGgS1eSY;ѪrpqqqIpqqqqqqqqqqqqqqC8!ooooooooooooo*ooooo[oooo77777S$888އx{  ݺVF[$ݝ'nn6AK~yn7sA|Q5,?r">y+=h&ӬYmVHx0 o o o o7 o o o o o o o o o o o o o o o7A Û  77Y !us &b|c|c|6[b|oor糸ֻ]\ u2;9*ج0CY XE````ޤi`````````````އy7q̛  T s Mf0V{11 ey+2L$lw B[vxR1|Q QnJy"PD 8MFƴ&wwwww3E }pX  @&M=nnnnnnnnݶ B Hw;F1yyOR(sϧŢ8Q.hU"aހހހޤoހހހހހހހހހހހހ z[O<@o7A Л   77?o +7777^u@oooooooooֵ /4(& ({ Yx0#ƉnW##t;}xxxi%%z_mny3zv4ŠgYZ7777y777777777777As[U u8M&a|c|c|c|c|3E}P^ǠoEG ݲF777777)77wYoֻ뵑6il8B4Vy^+ը[/1mQq>UDSa67777777777777777a֑i/]ozp B޸޸޸޸޸޸޸޸޸޸޸޸ޠU޸޸޸޸ސ޸޸޸9\o\o\o\o\oHpqqWmȴ![{777777I77wioڻ 0ijJ՘"i>U6Ok1,+Cpppppppppֵ ' /' <Ö248%sɕ,gGCYr:U Z5xU&չ7GFFF&CFFFFFFFFFFFF>dC&!yAF&AyCyCyCyCyCyCyCyCyCy_~yn q6u4YZˡ:^T0n10n0n0n0n?0n0n0n0n0n0n0n0n0nߡUXo``````$```Ǹ}0`KQ/EaKKQ/ECz7^z)ꥨ^z)ꥨ^z)ꥨ^z)ꥨ^jReRKQ/ERKP/ER ^z)ꥨZ8KQ/EԃP/ERKQ/ERKQ/ERKQ/ERKQ/z)2V'}W*KUݔQ7EuSMQ7P"Q7EuSMQ7ELn)Z*)l)ʦ(l)ʦ(~ٔO}ʦ_@ iU/rz=P= ӓƤ4ccoK${$,nLs̏~|m}MQvTcyn-mT];ur5Y]`3︾v2<ʫ/{jl"'}͓ʇK^t{₢:+q/s 7_<$/~ylui&DZ[o`.nvB۹~3r9B:g=s;޽`}XwS/veK$'_Qд{7To tc^ێE葰'vt1%q48=kq:OzEjC#]8./d{1AhoLx Q3$O $4*y Sg68uz=nxI4XO ?ɲNMTjyyg>ձޙwO0?88Y>LOכ_+ nk=1 6ݜkT77-7ѷܬZ|Y5z;VN@}.e8_ۋwqsz xpKҦ$HP DPXjk[}F?-#_AtxEҲ U}}ڧ=7N-|^v>|$vF|eCrקlGIm0 V޺{q6]u&Žōō2qdq!jռeTP(" w`F@@@@ܤe@@@@@@@@@@@@@@@! n777777777777777777F-7777A) n n CTPnPnPnPnP}FGGf ʍ ݲu"TnTnTnTnTnTnTnTnTΫ*7*7*w UnU*NӪ˴Z>(zCYnH>cbJ±T[%A/k"|3&_>ctaO\n\7A    \7\7\q?a*7777>qqqqqq!!pqqq*|0]ooooooroo3>77woߏx7B ыI'X\-;AD±\oooor5oooooooooooo:vtd: X7q›  O n Mf^{rWp[$ݝnn6NKR~j+<2=5:TuQݠ*e*cĴH"}thY|(rwqR1$cv 尜 Ѓ0Ui!~#~#~#~!~#~#~#~#~#~#~#~#~#~#~#~#~#~#~ B߈߈߈߈߈߈߈߈߈߈߈߈pV߈߈߈߈`߈߈߈9oooooHD~+\11111xj0-pppppp pppֵ r +' bcc_-|FxgZ/7=baCĹ.z0U<׿%²moooo3oooooooooooo:^&a|011111111111101111o1111 rL`|c|c|cVbtctctctct1iatctctctctct@`tctctctm эээээMээy;n~{nqɤG!R/UmY uoYء\xEg p-k#aO8M>+LdX^.y.HHHHHHHH0SHHHHH HHHH9$n$n$n$n$nHFPAAAAAYmY6777777777wZE`Mu3111[hp[aK R~j+<2Gȯd9QϫYOdy"3],_ˢ(?'UytttttttttttttttttӽNĆ&t`aaaaaaaaaaaa1`a:aalaaaa r00000LtttwRU$o$o$o$o$=~GFFFFFF@FFFn]Ӱ=(o(o(o(o(o(o(o(o(S77w)%R#8O qXV)>qYIS.^˒t 8MBFFFFFFFFFFFFBFDFEFFF&ȡwwwww3Eލލ='N'vvvvvv?vvvvUXWppppppݤpppmnn6r~=Dߊe.r*L s]eazd-lBd 8MFƱ&ȁuuuuu3E yGMf %³Lu nnnnnnnncX7X7Xwn%Xa)^?5AhWEJ ʉ3ju<B̫ZNOe-AvQ.lo~/R^gO77:]o]= {#{#{#{!{#{#{#{#{#{#{#{#{#{#{#{#{#{#{ BްUޠޠ9dododododoH'{?00000dpppppppppֵ ˰B  Fi%M^_Tmw,sQ*J?V󴺔UnެU eG````dh`````````````އy[`!0o7777777777777R77'77-7777A̛)0o0o0TPnPnPnPnP}VDGG ʍ ݲ|-^rrrrrrrrrw`aarۭdwu]ԕx_LU#\f9o:rT 8M熮&sssss3EύύuLޫ ݺVaY@@@@@@$@@@ݝ}nn6BV+nY>3&BUT**RE͇b׵>L7L7L7L7L7L7L7L7L7L7L7L7L7L7L7L7L7L7L7q  ӍA Ӎ Ӎ` MfLX ҽhu# @AAAAAI@AA;t -DͨHcӗo!L0n0n0n0n20n0n0n0n0n0n0n0n0n0n0ntB0n0nq`!0n777777777777777'77N-7777A)0n0n0a)666666X666666666/ii M yt;n#Lę,ť^8.* ,ϫzXt,L~~~~ ~~~~~~~~~~~~~~8M߆߆߆߆߆߆߆߆߆߆߆߆Ɩ߆߆߆߆F߆߆߆&ooooo3E e~Df %#I;qG@@@m@܆xH\<}dgY&DZ:CN'l"||||t ||||||||||||||8MFƥ&ȁooooo3E q|{>f EmD666666966v׽ń$66vۼmM?jxG.~xus9'R؅EUCs5JKPRoP~c mn+&asa9ak rL`scscsw澹R2{6n7n7n7n7n7n7n7n7n7nwZeFwwwwwwwwwww{-_Kq! LCN)dOt{y&^xU=`BiUڬpUuuuuuuuuuuuuuuuuuw^V%2x!Z7q ֍֍֍֍֍֍֍֍֍֍֍֍ E֍ ԉ֍ d֍֍֍MCFFFFfZZ ٽO/Fn]аnnnnnnnnΓ6d7d7dwndM^_Tmw,s2KOiU|Rc՛Ub< 8MBFFFFFFFFFFFFBFFFFEFFF&ȡwwwww3Eލލ}0zY  @KZg;kyyyyyyyyywvyCC֗,ukLe)*f'RL:QǙHLͪrU~7~7~7~7~7~7~7~7~7~7~7~7~7~7~7~7~!~7q ߍߍߍߍߍߍߍߍߍߍߍߍ Nߍ ݉ߍ mߍߍߍMf @{l ۍ ݺVyvvvvvvvvvwvaaavQ_}-^ʺeNQ*2clVBLC_zs՛^bT2z*_UE!l7l7l7l7l7l7l7l7l7l7l7l7l7l7l7l7l7l7l7q  ۍI ۍ ۍh Mf{l[ ۽poݰݰݰݰݰݰݰݰ-d 3@FFFFF&@FFvvvQۣv\S>Ġ+uTS6ę,?r"TX'Y<΅#>L Q['ŴRc߾IC!nnnnnnnnnnnnnd*nnNnn\[nnnnx7x7x7x7x7S$Ż:U o o o o }777777 777wZyxxxxxxxxxwAAAۈx-B]7i]8[џj7T&81[xW.UTl6@/P#B+t`aaaI`aaaaaaaaaaq aaaC0!ooooooooooooo*ooooo[oooo77777S$000ޝgJU o o o o o o@ o o o o o o o o o_*<'0,ț$Ȼw Fk rXO aGBuJ'x$Γ4Bd] i1||8 RavIzSa7777Y777777777777777qÛ P ߉ oMfû{] ߽*21 *"7$|w Fm / ^uTM,e9:.l 5t BS؜ص9nnnnnH; te} h fMy;BFFnmDޛ<4xCmLJG1Vyexls]`ppppppppppppppppppp BR؛ش9nnnnnHpU,A7w#Ip&77wnw`3Ӥ'Pcz~bE-za>SK1V=D膨ܨܨܨjܨܨܨܨܨܨܨܨܨܨ0ܨZvQC!TnTnTnTnTnTnTnTnTnTnTnTnTn)TnTn@NTnTnZTnTnTnTn*7*7*7*7*7S$ܨܨrPPPPPPPPPPPPPPP 俤U8^`T7T7T7T7T7T7IT7T7Twn TwXNQ2*I5HVTo:7ī8OeU]lbY F²`aaa`aaaaaaaaaaaa;]X֓t` B0000000000000T0000nnnnL7L7L7L7L7S$000ݭfTnnnn=y˂F}n@ް, @ Fj нak yT,|b=X{"dO=i~9yFiyު4tIYC!nnnnnnnnnnnnn8*nnNnn0[nnnnb7b7b7b7b7S$݈݈:Uoooo=F}Ӆn]ě$Ļ㈷ Fl%,2UfHQNZ 6k *ڬp]auuuuuuuuuuuuuuuuuuu Bxxxxxxxxxxxxx`TxxPxxPxxxx9nnnnnHu%-hnhnhnhnhnhnhnhnhnhֵ ρ& /j)l꺇8DeHR!Ԣ"b¶E-^ M M&sssssssssssss#Ossrssւssss"BtCtCtCtCt1AtCtCtCtCtCt>@tCtCtCtUa"t#t#t#t#t#t t#t#tw_(t[ GGxer_}$mV;Xvع M* cnZĵAC !nnnnnnnnnnnnn)nnMnn|Znnnn77777S$ Eu)6666llllll;llllUx888888888۝wmm6:f{med-n },n,n,n,n,n,nr,n,n,[!77w -n?jrXO ,C6*u4S..BmyхNu+b,ˑG!euQ&RY-.r7r7r7r7r7r7r7r7r7r7r7r7r7r7r7!r7r7r7q ܍܍܍܍܍܍܍܍܍܍܍܍ K܍܍܍܍ j܍܍܍MCFFFFfrX @KZن}}}}}}}}}w}MC|X\\XbJ.[{ѺDFFF&7CFFFFFFFFFFFF>dB&!waA;Am rL w#w#w}BqCqCqCqCq677<_&6@@@m@\{\<{^Uj!TxKIy"Zn܍*$swQ,m$ 8MBFFFFFFFFFFFF䆛BFDFEFFF&!r#r#r#r#r3Eȍȍ=Ic#3|n@s /I;smĹ[[!k L7xB%\3c).^9iR}8bJq2/Y\ebyqmgn7777 77777777777!777qț  R q MfȻːY  @KZG~~~~~~~~~wAAA[~E>x_OV|^V"٢."OJRo^n@ ,oooo3ooooooooooooMo7A    77wG{zn_\۰B0n0n0n0n0n0n0n0n0c77w1nM8N(L#k՜DWluYș[ʥr Uaj!ln676767676767676767676767676767,'6767l-67676767A)lnlnl?xi*T7T7T7T7T>kmnnnnnnnnnyFCuCuCuCuCuCu@uCuCuwLnn6RnWi;P#ʡĩ+c=FԵY>e\N Hb,bݲ6k#,nnnn6nnnnnnnnnnnnf8MƤFF&vvvvv3E e'.So4777777 777wZE`x M qn#m~9,G˞!t}Ck/v8Od.ndFRjl/j1"(1)-sY(8&7777i777777777777777qϛ V uMfϻ{W{{{{{Gf  ݮVa777777I77wǁoໍUg^6HӗoDcRUSYa6v7v7v7v7v7v7v7v7v7v7v7v7v7v7v7!v7v7v7q ݍݍݍݍݍݍݍݍݍݍݍݍ Lݍݍݍݍ kݍݍݍMfv[  @KZrrrrrrrrrwv`aa[ra[XB7įqHpjT6cTOj !d..eh'd"IӰ 8!67q ͍͍͍͍͍͍͍͍͍͍͍͍ <͍ ˉ͍ [͍͍͍Mf6]  @KZEztttttttttwvtm]3IBS<*|($7$7$7$7$7$7$7$7$7$7$7$7$7$7$7F!$7$7$7q  ɍ7 ɍV Mf`H - AAAAAAI@AA;p{ mD !Y:nXRxeD*UJfҏc<ܢB 6B ,8M솳&avcvcvcvcv3EٍٍQ{Vѽѽѽѽѽx "totototototoLtotototֵ u& <{{{6[{K~$K)*}uuuuuuuuuuuuuuuuuuu Bxxxxxxxxxxxxx`TxxPxxPxxxx9nnnnnHu*Tnnnnnn>nnnnnnnnn_*<;0L$w BۉZ p{PR449K~j6#iZU6! XCܨܨܨjܨܨܨܨܨܨܨܨܨܨܨܨ܇r!Tn*7*7*7*7*7*7*7*7*7*7*7*7*7*7*7 '*7*7`-*7*7*7*7A)TnTnTPTnnnn}RT7T7T7T7T7T7T7T7T7Tw2$Tw F;h / 񫬅W[ D7D7D7D79D7D7D7D7D7D7D7D7D7D7D7D7D7D7D7q  э? э э^ Mf{D\ ͽOۇF|n]p I; sۋKm6 >qעPce)$֛ǹJ$T ^2cYfStBܬPqnnnn27nnnnnnnnnnnBnnn\7A    \7\7\wPě /`aaaaaI`aa;x[000md0/8{Vxd:!ǹ,PVuOdn;y;lAx뭊  n8MBFFFFFFFFFFFF놢BFDFEFFF&ȡuuuuu3E֍֍QGgAt ݺVaZܠܠܠܠܠ$ܠܠܝGmPnPnP6f+Qno0;iD噰"ۺYHDxmOttttttttttttttttttt@ B T 9nnnnnH@AAtݘݘݘݘLey7$fٍٍFj/ i>JcURv%e"ŋ8dR2wFoчG5kS^J9V@HHHHܤgHHHHHHHHHHHЄHHH!$n777777777777777777H-7777A)$n$n$m5*777777777777777/iixxxxxxxxxCL~%ˉrzAKCFħ8#]a֪C!pnpnpnpnpnpnpnpnpnpnpnpnpn)pnpn\NpnpnZpnpnpnpn8787878787S$ùTnnnn=z;DFFFFFF~@FFFn] 7I;uG@@@m6BVdgʢs>NVU\ k/uy:HsHzKsQqYeZ$Rkx pqqqIpqqqqqqqqqqqqpC!\o\o\o\o\o\o\o\o\o\o\o\o\o*\o\oHO\o\o[\o\o\o\o77777S$޸޸އz?00000{c~].!p\o7A     77w|ΑぃEぷUDf`D~m3Q@3<7nd}=ͬvR Ln\ƹC*c9r$v$O֤?jK%|-@p 1o"7 V^+.ʳ8`< 1< N{W3Q+`TO>Szw.ˈ|s8ߜo7|s9ߜo7m|8ߜo7|s9ߜo7 |so7|s ro7v|.Rwn|&+ߍwnߍw7nvn|7mwwNn|wioi^^Uԭ{T[G`>.샓t\yxn8AY58Wx|\z8!8 . |c0ߘo7|c1ߘo7m|0ߘo7|c1ߘo7Ͱ|c o7|c ro7v|2uq8p8|5uǁq8p8+ǁUtڭ"i4p8 Ni4&jy4_IYN[ׯg r:nVb}'7NrHqJ}ӾiVoo7M}Ӿiߴo7M~wH6Ѿ Bo7M}Ӿiߴo7MFYѾiߠO7K}Ӿi97M};DB}ӾwYҼi4o7{C)͛MyӼi,7͛MnV݀n@7 F>݀n@wS$t݀n@7" t<Н݀&i_FyF'od\l\ͽAwI͹|iW %e5VdvP}/Q_ #x]KNVy߼o޷u}y߼o7}y߼o }y߼o7}y߼o}Qo7m}y߼o޷C$o7{w]G#q8z!G#q8B!n"E`;Q+)q8B!@#;Ogq8Bx$Bj:8o~U-~r|87e9 fgէ7q9=,'\ճ0,oU7;ؼN%Հ"O9pN8' s9pN8' 焃9pNqns9pN8' s9pN8 s9]N8' 7q9pN8'!N8'N] a0p8Da0p8 n"EWEYa0p8 a;0p8 x$ V^ x4?ώg Yy. Dy_ӊp8o7 yq8o7yq8oqmyq8o7yq8o7 &yqޤ[76q8o7!7;_ r@:~{a r@n 7 r6Zqqy?lvc:o`|rVszYDRnt%ݍFwnt7ݍfn Fwnt7ݍFwn.ݍFwnt7mCwntC$nt7{x* w?p7 wnp>m%EۍvcnKl7۽lwvcv ãg^+D&Dts9ݜnk4N7ts9ݜnN7ts9!NAts9ݜnN7ts9*N7t#l9ݜnN7 ts9ݜnH8ݜnN9yI* s7u`n07 &>`n0w.nl%9 sܖ`n07{a s7 sˋSލ^jUuP.Ϊ]嫠Z(TɨuDw (uqݸn+7\7׍uqݸn\7׍u?`㋇p!\A׍uqݸn\7׍uq,*\7ԉulqݸn\7 uqݸnHpݸn\NrBU7 xo o7 @@!ow&4xC!o7 x<݆xC! DNC}q~:.^~:/dz}zZMXz[*X,n7fqY,n7fqY/ J~"qmbqY,n7fqY,n7hpYܘZ76ȱY,n7!7ŽW_oFj#H aFj#HmRFj7VAj#Hm6RFj/w B{}]N>~IPwp|~[*Y:6pwwxͪNǧz~v$~\t$[[wv~}7>=vhW>4K[ba_kvuM+J6y}cq|<|֧W~k.ɭ׿ז}-M^ k}^p})]@KQ;ҨiTMujw T'HF#Q5}-#F'|>wOO8y~}i;+npog +3U{MesLM;q{Aӻ?G{Kqы^O}a'6dDm6d{*T7 ponn7 ypmI pn7{ p7pw8)GAfbqz0~Y[O[O-mXTSlqyӠ踜^v7MFqӸi4n7MqӸi4n7mqh4n7MqӸi4n7ƍqӸA4n7MqӸ r4n7MvMqus¹pn87{8w sùpn s7n%pn87 s[pǹ87@;mν_fl|b4?FV{9z/PjV-OX=/96(7 6rCPn(7 rCPn(a!(A rCPn(7 rC)(7 rjPn(7 rCPnHPn(Nw|)*ōFq7)ōFqQ(nōFq7kFVQ(n7mFqwNQ(nw)IwiNA2.VI9> q9 t\UCzs)W qø`0n7 qøa0n716 B0n7 qøa0n7 &MaN7S qøa97 q;DqøwQq8n7ǽI;qq8n7qq͛q+q8n7Ǎqq;qg8n7wi]ߌePϋ/OOI+xRy9}=U(xV_U)ǓjЫۈ؋8!6M&s[dn27M&sdn27M6 Bdn27M&sdn27MNPN27ZK&s927M&s;DB&swTR!ݐnH7ҽ0 tC!ݐnH7 tCUV-Zp|q,nV͖yeamUvncm6vnc.Emv ncm6vncmvMncm6vmncmC$m6v{;o#6~om6~ݼ"VTm6~mowNmv%[o?>~y eE GW4c:q\^h ލFڇҬx?DQ3 nfp3 n7fp3k{х' n fp3;Jwꐷmyۼm6o&myۼm-omxۼm6o o~=\u ݆nCMf^݆nCm6 ݆nCU$Q+I'm6sfn[07S6sOҸtGףzgz߃rRe5̦G&DfNj$domK46{fom6{fo?<ގL!Afom6{fo`)6{focim6{ fomHmNw)fp37I{afp3 n7܁fp3UDn7 p[@!G37@;n7/߽[||T_Xf6*bGj8 gq46iMڶ#mIۤm6iM&mIۤmR lCmiM&mIۤm6iM&m1Rm6dMچВIۤmҶAM&mIIۤݐG`tVpridzG߂v|kQ k9X k,6X nVQM[Qk`mEX yX;k !yGo1/I+cCv{_rD?d|DA8&a8'|cb{+;I^澒QӤ(”fv3-nf7fv3nf7fv!f7fv3nf7fvn\'m`v3nfv3"av36W]׮"p8|aG#p8G#wd;o%9G#p8| G7OB/o|>;y[ئuS~Ն<+y+/uht6`z]_o &`"K"7 }þa߰o7 }þa߰o7m}`߰o7 }þa߰o7M}þ9oط }þ ro7 v }7ފT`o7P: 37 {1`o7ݬ"jg${`o7" {<{̓N)wh4ޚ7Uy6?F?T3iwA Hn$eɍFr#Hn$7ɍFr#kf{a^4Er!$7ɍFr#܍%c$7ɍFr#Hn$7MEr#HnɍFr#Hn$7ɽJr ѠA[E~ '~\TzV_O-"-i0]kA ;SmGy4S>;q߷'btXkw5w/[Y'stPNկR/oQۛ?8f9gN}6>\=e_;z}֗}ze˟募}S7z[㛴-ozW7i {Q;ovEnۄ/wӤf{l/̗zPir7qmb#PXwQ no rZ9LhqvzN^gI:\(AM:^~v̹l\t$[[w:v~}7>vV4K[Na_Mlvu *J6y8}c1{Uy6?Qz4&`/UknT7m]FuQݨnT7ՍFuQݨFun FuQݨnT7TwՍFuQݨnT7ՍFuSlQݨnT7 FuQݨnT7ՍFu_V0:zW犃8n]4٣i;O/4LHۤm6iMsJ&mIۤm6́M&mv˜Ky*r@X,%KdKRb)XJ,%KE,N.KRb)EXJ,%X*KRb)рD,%KmW,6$XaXJ,%rE,%KRb)XJ,e"TRb)XJ,e KB,Rb)Xh@*K+*>Kn瀰XJ,%K9"KRb)XJ,%2SBwJiRZ)5VJ+V*JiRZ)L+JmW+\+U\RVJ+JiʴRZ)VJ+rD+JiUdaJiRZ)V@+J~+UhRZ)V`@Ji| L+xVJ+J9ɢJiRZ)VJ+2"ʹRZ)VJ+JiRjkRZ)V`@JiϷRErߴ\ o8Lʣ}/+K+{X-_kjw´?X>{{ჽd/X~thzxg}.Ga՟8?O\VNq[\|W^vD/8ӧl?37 "rvsGto/ߍ"|Xn^$ބݤ;z]*5^>_j36dPF#Q5w}v#_;/ɲ{<<ݓӨ}&y_nΊN]k>owe&W6xx8l4ZܓԴsg?z0}zhvO@v<.zQkIo9tc!Ӎto:܂TTo7՛MRTo7՛MzSMdȲՉXo7zc;zGXo7ֻwV4׸|T9 [yl9,qO?=bni;0fn31;{afn3m6ցfn3UQ m6rm Fn#w܎۷!US)èbՔjJ5UT>JI\RqJiRZA"#VJ+Ji'JiRZmi VJ+JiRZ)ηRVJ+Ji.$Z)VjZ)T_SITS)Քjjkֺ)ՔjJ5RM9cRMTS͹! [y*MɦdS)ٔElJ6%l*M&8ghNTNEA;椫YIa|0nfXGfX97'I'in9t~]}&_?]gR^?^GwzuU50zhF/3ӨZk-_rzv]9 [mfW_,hRM$~|| lpVD<$ŵil`8,z[/W?+L[>#~X]zð[+뱢ws"g5ƪUgZugcGcK|L{c"w:f`>{޵4<T]6~(^DRяۜHjWj4+7 ߣjmĪ!*:aһ䃬vێhxrӗOe\_me W _6\IV|U^q?Gd^*ݕkW}xi5˹8p÷Gx_WX}ٗW[|=Z{i7|z}|<{_vEF "8.*ï[7hX i yq|atQ ^;AEA>8Ԅm_/E9PAhc/iz೿ߏ72 *nvNoO齏:y%sm~71|W[_:}1禓q-4o[oKw~K.ک#[rZKǓxtw/GPQ7k ~)ˏ]^~>d4r\o;]F~kKt,/57yV⮎(TI@M^;O/OonFbu/Sz?!RB|OTp>rOE$x3{vy?SxMY1ܩkh?֧-VW7F{B6yY@Oh.E/vzMnRJ)RJ),RJ)ԮR.J)RJ)ljB)RJmU)U|R+RJ)3,J)RJ)RJ)RJ)^H)RJ)RJ)RJ)TRJ)RJmRJ)UTTr4X)RJ)aQJ)RJ)RJ)RJVQ[PJ(%J RB)PjCPJ(%J .tRB)VRVn\NOߎ_+?*)GUR*)JJJ%RITR*)]lI;kEmLJ&%Iɤ,dR2)gRLJ&%I]ҡNJ'ڪN* ?JB)RB)P PJ(%J RB)]Lv+RB)PJ(e J v=B)PJ(% "PJ(]TP*JbB)PJ(PJ(%J RB)PD*2NJ'I餬tR:)wRNJ'I.;X'ImW'JuRtR:),:)NJ'ItR:)褢VtR:)NJ'e IvuR:)NJ'uI%:)Nj:ӝTr,X'I餜`ItR:)NJ'IE'T'ItR:)kNJ'TItR:N*ItRI7uR[RE(UPJ(%J e,0J RB)PIPJ(%jijJ)RJ)RJY(RJ/RRJ)RJ]RRJ)ڮR*d)J)RJ) RJ)RJ)RJ)RD.HhRJ)RJ),RJ)ΗRRJ)RJ).K\)RJmW)U|R`RJ)rE)RJ)RJ)RJ)e"T RJ)RJ),RJ)RRJ)RJ).KB)RJmW)t)J)GRJ)RRJ)RJ)RJ)lQn%mRJ)RJ),RJ)ΗRRJ)RJ).RJ)vRVv4WshQ-uRRj),j)ZJ-RKRj)*4nEZJ-RKRj)ZjkZJ-RK.kZJ-ڪZ*?[K%L-到ZJ-RK9ˢRKRj)ZJ-2"MZa$KRb)5XJ,%X#KRbq(K+>y4m  J RB)gXRB)PJ(%J R&wUE+-RB)PJ(%J R;J%O/ RB)PjJEB)PjBx%*GT'*.(Li4S)Զ QLi4S)͔%)͔fJ3ռ|ډhJ4%MDS)єhj磩H4%MDST,M+JFSTJTR*)JJ%5'WJJ%RI QITR*Mðg*)JJ%RIYTR*bm*հHza4W'Y'ՉusՏ,0 so>ڕ隣MFfX9fWa?IOLwӴrv"L~ϤiD0}Vfh^7r4zFyr؝}rǿ>궂 Q+7Ÿ 2xa>м.(\=yL/nЊ'wv0- Eseveۻ}-{qL8+<3aWeE7daeEϪ, /\U,Od׏ǖd :/oyOˬE|okEx4laQdh?; W$9ԮhpW`ox/"]]<Ul#VQ޵'d[N|Lg?폦{oчry4z\Y}ӽEx~`'W~ua/jQ{+Nڍ?}uRȕ7y "rus뎄 Gt#ï[7hX iЉyQcTqYq(nx#"&ag94lt1ZY:6pwwxӧsn:Y"I֝ݱ_ O7{z:՟=?;)r%-'G0W0jQ_ޠdo7!3Ɨ;<`}h~wl/׿ז誙s--^Jkq^p}],KQ;b1TMw2>^$ބݤ;z]4^>_j6DGF#Q5w}v#_;/If4 sd4j~ק񰛶bS?>/;;[p-] o-+g'd5mُ r%1=#Ш]"^x[;ѵtx$kõڛN"jS6d نlo2wnd نlC!06d nnd نlC!m6d{ نl7ΛlW_hz,wZM p n[m6p nm$p: 6m nm6p ܦI۬M6pE n96p n;Dn}W·m6| o÷m6| ߆oVY߆o÷mE| }|;oW^| ɓnMT=xe߮<ݮ¾߻-q|Fm<%?/>9?wɨr}TdTj%Y_XOQ/~ﯿ[}^a{Wz|X5\f~X*֟|j՗Gv~W_fy?$_{PK1Xt0*word/_rels/document.xml.rels][sF~ߪ)nܷ&3EJ,2#meI4I 9 A= J@&T$7~>8e',ɯo[/"Y LVo{K$Lįoٛo"9\m %~}{-"[ e)Әkz _w0wio~p_΃_ߤ<˟[#erQ";.pCDX!/oͻw˼w%~;d|K^$A" Ge/5ǾIE {m͡H8?-r&5*B6:Hy ˼?ճTU*?5)d-mM-rL$oݻk΃,Ly 7&Y^l"%|H"aB` w~9Y(+' !yigz(=wR),"],I&!\"NʔhK0W"<"D!oؾP0zQ27O8ǁ4]L#0IDu%h"r"a*Jp?HA"HasJ VF!FLfo9g M9Op_0hF0ϲ <<"x!#X#m %P[4x{M/  `;AE|i= ggmU! &SEf.W/HJud({-xlYm+"ek'%V>x`o|E~[''XGe01Oak1 8퇣{A02 YsxT,E/T}(6dAq)T.DPO.#r&7d*dmDCX"]"olê3tBd;ex |K7,/nGXdo"hXOk-{v'#, BDWb!<ďa?E dfBnH%s1,c8~]ҵG$3EEiMJlU[E.EQI|)`B99Ka4\aQMՉQd/?B͗F1FE-oѡ#D~qQt^Es((NFE-bE_Eбy)'2^-&2ܖAEHsb"D ?M$z,|,i(x3XX%IVR&ApX=G'+ԢX_ӛ"ʋt]dTKC!J& Xǔ2`Bŗw;tuVV E.-mI+t;8K`NP;a㢘ӼRX>|E"ú{׮%ݿ.kLQrbZU/|:є܁B(Lv2ŽPWU6[0`HȟM?}![=ŸoX2I\tBވ8MY (xߴwaZr4lvc{?6I9>VD*٘5FSMfHЉ%RQYHw1CK;TlʇLogʹxɜmFOoWeYVU R$(%({| Y$eF$Zvef-S*ڧz-%tU]J`5WEy*.K< [D& |1b5N]ejx0-#jFj𴳼a1^(F١*󍿆 UQ_hFݔ1j;V)An/٨z7%dj &*=*PL-7ԯ4WRo}qj=B^+&b"HqHN7ڌ5*KG}` EN=nn 7Z,Z L)3W,xfeBVlʶ k{9RjY mOM[yB_76;@7X\$\ ?T[*˙!FX2,IdR(s 5y, +bIAs(biZ`Df x>Oj"9ƼPuOf_gD<u]Ǯ^@$a%]%\E#5\ Z9Ԡ#\&J_Y%,&g#K1O Vr9hAcNVez(TĮ Ptm =O?D X_nM"ⰯӪ5 ť`z˔#{!E*pED͟k.VҿG̡R |E̡곭m$OU=JX56ؗp3Y7u_M9"@.WI`%צ,izZ#:…ܦrª2Ky.VXф,]fPU3٢r@(WRzb m#vd 怊xRvJ3Ip0U6\$=aMu% LdJ'A)cUP{(6ϔ =;µj䮩-<'1k(M9hNEG ])lUڬ<ؐ,YyD,H be[fB7e4㮈e CU>nllU`iZ-щ UmTiٳ~~$بL=l␌y )CBIsv^-:#\ȴxh/]/ g˔]O2euy[CH_ZdȔ KU.RczӋBgKNx+ʐ.*$2gX/LjTg 0W'֪⼴@U9)>OU$CH*P,"@l&5>Iǯ<9UbZU']i )!j‡8$9Ry*bhM_X*|هq:ʿ]gժ;ج& e~//jHMp}X y#r?\`qGo뻾QZZ`z xPزh߻dWy#YVKCXvA*mZ?(b+::9IkjJ7g#UITu WoRl:ur_9*i~=$[Otp8듛 ;R@.nS-X*EQI]*DjQ׹]TizgD; Wƅ'golsnPԛaeS:k[['r,"|DJ7+kӲ.A";)r=*on7-Y7Q]En6 Xg"F^n=ju:GreI~vA>b'Xn Z9YǼIg? M~lU5x!c,6Q] 6b5lz6l&)lmx~Tu}2˛Ilچ )gȔc8[ Rƛtf?h 9zNndTG#L/̕ MQq@΁:lwN bQM`ǰR1#2=Z;T1?5T I.` 28hb^rخ㡳0HzkqHdr"qOۍnݧ8؃]&rt1(VPp+YmN2.g򃝜D“ZegM1(NETTUPI(E G* G58jzwђ:^}Zm$5Vݞ=VS|M[TQ@r,ǚlAu')̀\m»|&prmk]7m;PSF˖ h-z旯G湣+3DpT?cZJoء &jP7su{, O@4/RU+à胈{e/HbCGõˤozU% {8:GO6Q|C-jzi4 i&8bS幬)v1Leشal.:zu>ԙ׀7 k3ϕk.kWނ>í#q4|aWm&IEК6 E+)s?e!z:7LI6RbݻE*u,jv9V6AC0ehΘL2Oz2 %V@Dt1dτg%l'Ur5`19JBYX}: Lmf#%,l)g8Mv -aupW JCJڤ$'kS`ttO0[,VXއ)]8M#6HvmzpuVaiIlb DFj C*1:ބC V'j3UOe֪-ycZ LƊ+&5NIPjzE"Y ?y :^]JcoծekՅit@/Zqu,^iSܵ`8EbH+Ɣ2Rf9xh(թev: JC56@w\ 6$9׺NZ:k2vtU뵥9րcPX3|ŀn~ s;j,r 7 ,XŐ^;X^-z1̗Gav &Zl%e]JŖ}HC6]+jB.j=wH6Q:&3{Uz֐d Ïͦ)ҾCqdP= 6wHQ$Ā,Y(>!1 ;:m=kGD { w`퇄?LlYi MGpp0 A8P䞲c8XpCJc83|kPAq&.:Cr?crÀOxfpgq0~8 Ƞߩh~51 DZh;0ٕ=eY^?蠊3Z8 UsB@uL4dbӪ``ja` =\7I2S( rw*5b501TgL&BDk#_PK1XBL]word/settings.xmlYKoF/Ay5b?T |L0NȋF-0&=J}h3"GWUW5?*gƵo7zk󢾿.]:J[Ѵo?>Zu]Uۛrnw15;몬Ww2ph[[5YWlKyr~coWN"UugYݮؚ^wdP4.)[i'iշJp? yMM:X祜",/|1ڼoB'.{ެYhfxw>jd}*6.s˔u٦s uf`lt3#:05kӪ1n  ͗=]v(llK30ԝ Tvln-xdrZ_lAqpF]m;|>yyu%^:y8VzRgE9χ 29 Ud"7w}xݱ4)8s]a:vH"XW@A󯐐wƤ&lȌ,9>9wSVvƁ"-{&ˡ~'C=`wpL:[}8o;9}ꐷpRz,8-32W_8½D\Ad@qDH[EH6*#K'N}h"H \A$IНC9F#L#$iƇh_ \Z,z0/z(izr R#" E:$#}(|#<~B$1XMH,c*IKz/(9 %Ne$ GYS~"XqDF MA{"DWJ4e$y}Nq34wJA[8%8O@8)^Tq@+2LTWlKyy*#2ƻs@G: i4E'ew ZV<{VPQ"D~BzBUF.TDwPC}j4Ph=GsN,fYJ$W£[.-QLpDJNQبX STOKw"' i@sm Jp ঊw(U-J$B2)Gm $tTJj62$h (Z┤xML<0HS=sIIWf!^aE[ $)|d b1' q7 #Px܂븞Xrܣi*yit?}W~ϩƧ~ 4F(6f{ٯظ]1;%>l&p2uvm\f,¡~~OfD\֌i Yݧa/C?fa3/Nҭኹ͚flͼ,*{^6#6d~gpщvM4v41ę&'icc\Y7ǞeiLEˎ=fnڦȫs?*S̎нXc楄~~-_0)-$z[@:<@hxY4:&#|~G:%BNaF 7f'lb#ԧЯ\ Lg B1\4tHPK1Xj*[Content_Types].xmlMk1EW㕝C[9 BoAfm5qyy4Փk $WbZND^co_EQMP-_|o#`jXoR^SX#uHNJSKg'4!PuCH_zKUº"A$*jEo^qL%+\و#Nxn3U'H@qTcHF׎q um5tSЀo뚲8e^#5"NL$^[@boFg m?`_X0޹xa R@>YB71<; чu/+ə Uqɟx* k v`yH?Cg׳,ePK-!N _rels/.relsPK-!~A  word/footnotes.xmlPK-!K; word/endnotes.xmlPK- !Zdدword/media/image1.pngPK- !kW66 word/media/image2.pngPK- !Wiiword/media/image3.pngPK- !1lnword/media/image4.pngPK- !;ijword/media/image5.pngPK- !mMMXword/media/image6.svgPK- !fqqword/media/image7.pngPK- !p4_4_|word/media/image8.pngPK- ! Eword/media/image9.svgPK-!F Gword/theme/theme1.xmlPK-!!NcustomXml/item1.xmlPK-! CaUOcustomXml/itemProps1.xmlPK-! Nh6''Qword/numbering.xmlPK-!Oviڇword/styles.xmlPK-!jn ؗword/webSettings.xmlPK-! k "word/fontTable.xmlPK-!xW)|docProps/core.xmlPK-!XՆpdocProps/app.xmlPK-!t?9z(customXml/_rels/item1.xml.relsPK-!.lword/_rels/numbering.xml.relsPK? XKDW#word/media/image_rId17_document.pngPK?1Xʄ!7Kword/document.xmlPK?1Xt0*word/_rels/document.xml.relsPK?1XBL]word/settings.xmlPK?1Xj*[Content_Types].xmlPKJq